RNA amplification method requiring only one manipulation step
Abstract
An RNA amplification method is particularly useful for diagnosing bacterial or viral infections or genetic disorders and for cell typing. The method includes the steps of denaturing a solution containing RNA, synthesizing a first cDNA strand from a suitable primer in the presence of reverse transcriptase, denaturing the heteroduplex formed, synthesizing a second cDNA strand from a second primer in the presence of DNA polymerase and then subjecting the cDNA formed to a sufficient number of amplification cycles. All the reactants and solvents are first placed in the same container to provide a single manipulation step that avoids the risk of contamination.
Claims
exact text as granted — not AI-modified1. A method for the amplification of RNA, in a sample, comprising:
a) obtaining a starting solution by adding to a container comprising the sample, a buffer, a first primer, a second primer, a plurality of nucleotide triphosphates, a sufficient amount of an enzyme system having reverse transcriptase activity and a heat stable enzyme system having DNA polymerase activity, and closing the countainer, wherein said sufficient amount is an amount which, after the heat treatment of step b) below, will retain sufficient reverse transcriptase activity to permit performance of step c) d) hereafter;
b) heating the solution obtained in a) to a temperature sufficient to permit denaturation, said temperature not to exceed 75 ° C., and maintaining said temperature for a sufficient time to provide denaturation of said RNA without inactivating the enzyme system having reverse transcriptase activity;
c) permitting the first primer to hybridize with said RNA in said solution;
d) bringing the solution obtained in b) c) to a predetermined temperature from 55 ° to 75 ° C. and maintaining said temperature for sufficient time whereby a first cDNA strand is synthesized and a RNA-cDNA heteroduplex is formed;
d)e) heating the solution obtained in c)d) to a predetermined temperature whereby said RNA-cDNA heteroduplex is denatured to form an RNA single strand and a first cDNA single strand;
e)f) bringing the solution obtained in d)e) to a predetermined temperature and maintaining said temperature for a sufficient time whereby the second primer hybridizes with the first cDNA single strand;
f)g) bringing the solution obtained in e)f) to a predetermined temperature and maintaining said temperature for a sufficient time whereby a second cDNA strand is synthesized to form a double-stranded cDNA; and
g)h) denaturing the double-stranded cDNA to form cDNA single strands and subjecting the cDNA single strands to a sufficient number of amplification cycles to obtain a desired amount of amplified product;
wherein after step a), all steps are performed without subsequent addition of any ingredients.
2. The method as claimed in claim 1 , wherein in step b) said solution is heated to at least 60 ° C.
3. The method as claimed in claim 1 , wherein in step c) said predetermined temperature is a temperature which permits the hybridization of the first primer to said RNA without permitting hybridization of the primer to an RNA sequence that is not absolutely complementary.
4. The method as claimed in claim 1 , wherein prior to in step c) said solution obtained in b) is brought to a temperature which permits the hybridization of the first primer to an RNA sequence which is not absolutely complementary, said temperature being at least 40° C. and lower than 50° C.
5. The method as claimed in claim 1 , wherein in step c) d) said predetermined temperature is between 50 55° and 65° C.
6. The method as claimed in claim 5 , wherein in step c) d) said predetermined temperature is between 50 55 ° C. and 60° C.
7. The method as claimed in claim 1 , wherein in step c) d) said sufficient time is less than about 15 minutes.
8. The method as claimed in claim 1 , wherein said enzyme system having reverse transcriptase activity is selected from the group consisting of avian myoblastosis virus and Moloney murine leukemia virus.
9. The method as claimed in claim 1 , wherein the amounts of reverse transcriptase activity and of DNA polymerase activity are such that the ratio of units of reverse transcriptase to units of DNA polymerase is from 2 to 8.
10. The method as claimed in claim 9 , wherein said ratio is from 2 to 6.
11. The method as claimed in claim 1 , wherein in step d) e) said predetermined temperature is above 90° C.
12. The method as claimed in claim 1 , wherein in step e) f) said predetermined temperature permits the hybridization of the second primer without permitting hybridization of the second primer to a DNA sequence that is not absolutely complementary.
13. The method as claimed in claim 1 , wherein in step e) f) said predetermined temperature permits the hybridization of the second primer to a DNA sequence which is not absolutely complementary, said temperature being at least 40° C. and lower than 50° C.
14. The method as claimed in claim 1 , wherein in step f) g) said predetermined temperature maintains the hybridization of the second primer.
15. The method as claimed in claim 1 , wherein said sample is deposited on or attached to a support.
16. The method as claimed in claim 1 , for the amplification of human immunodeficiency virus RNA, wherein the first primer comprises the following sequence:
CCTATCTGTCCCCTCAGCTAC (SEQ ID NO: 1).
17. The method as claimed in claim 1 , for the amplification of human immunodeficiency virus RNA, wherein the second primer comprises the following sequence:
TCTATCAAAGCAACCCAC (SEQ ID NO: 2).
18. The method as claimed in claim 14 , wherein in step f) g), said predetermined temperature is at least 50° C.
19. The method according to claim 1 , wherein said RNA to be amplified contains or is capable of containing secondary structure.
20. The method according to claim 1 , wherein a sufficient time to provide denaturation of said RNA ranges from 1 minute to 15 minutes.
21. The method as claimed in claim 1 , wherein in step c) said predetermined temperature is at least 45 ° C.
22. A method for the amplification of RNA in a sample, comprising:
a) obtaining a starting solution by placing, in a container, the sample, a buffer, a first primer, a second primer, a plurality of nucleoside triphosphates, and an enzyme system having reverse transcriptase activity and DNA polymerase activity; b) heat treating said solution at a temperature sufficient to permit denaturation of secondary structures that may be present in said RNA but not above 75 ° C., for a time sufficient to permit denaturation of secondary structures without completely inactivating the reverse transcriptase and DNA polymerase activities of said enzyme system; c) permitting the first primer to hybridize with the RNA in said solution, followed by synthesis, at a temperature from 45 ° to 75 ° C., of a first cDNA strand, thus forming an RNA-cDNA heteroduplex; d) heat treating the solution containing said RNA-cDNA heteroduplex at a temperature at which said heteroduplex is denatured to form an RNA single strand and a first cDNA single strand without completely inactivating the DNA polymerase activity of said enzyme system; e) permitting the second primer to hybridize with the first cDNA strand, followed by synthesis of a second cDNA strand to form a double-stranded cDNA; and f) denaturing the double-stranded cDNA and subjecting the cDNA strands to a sufficient number of amplification cycles to obtain a desired amount of amplified product; wherein after step a), all steps are performed without subsequent addition of any ingredients.
23. The method of claim 22 , wherein said enzyme system comprises at least one first enzyme having reverse transcriptase activity and at least one second enzyme having DNA polymerase activity.
24. The method of claim 23 , wherein said at least one first enzyme comprises at least one enzyme selected from the group consisting of RT-AMV and RT-MMuLV.
25. The method of claim 23 , wherein said at least one first enzyme comprises RT-AMV and said at least one second enzyme comprises Taq polymerase.
26. The method of claim 22 , wherein said temperature sufficient to permit denaturation of secondary structures that may be present in said RNA is from about 60 ° C. to about 75 ° C.
27. The method of claim 22 , wherein the RNA to be amplified is human immunodefiency virus RNA.
28. The method of claim 26 , wherein said temperature at which said heteroduplex is denatured is above 90 ° C.
29. The method of claim 28 , wherein the second primer is permitted to hybridize with the first cDNA strand at a temperature from about 50 ° C. to about 80 ° C.
30. The method of claim 29 , wherein said synthesis of said second cDNA occurs at a temperature from about 50 ° C. to about 80 ° C.
31. The method of claim 22 , wherein, after step a), the container is closed and the container remains closed until the desired amount of amplified product is obtained.
32. The method of claim 22 , wherein said first cDNA strand is synthesized and said RNA-cDNA heteroduplex is formed at a temperature from about 50 ° C. to about 65 ° C.
33. The method of claim 22 , wherein the second primer is permitted to hybridize with the first cDNA strand at a temperature from about 50 ° C. to about 80 ° C.
34. The method of claim 22 , wherein the said synthesis of said second cDNA strand occurs at a temperature from about 50 ° C. to about 80 ° C.
35. The method of claim 22 , wherein said RNA to be amplified contains or is capable of containing secondary structure.
36. The method of claim 1 , wherein, after step a), the container is closed and the container remains closed until the desired amount of amplified product is obtained.
37. A method for the amplification of RNA in a sample, comprising:
a) obtaining a starting solution by placing, in a container, the sample, a buffer, a first primer, a second primer, a plurality of nucleoside triphosphates, and an enzyme system having reverse transcriptase activity and DNA polymerase activity; b) heat treating said solution at a temperature of from 60 ° to 75 ° C. for a time sufficient to permit denaturation of secondary structures without completely inactivating the reverse transcriptase and DNA polymerase activities of said enzyme system; c) permitting a first cDNA strand to be synthesized and an RNA-cDNA heteroduplex to be formed; d) heat treating the solution containing said RNA-cDNA heteroduplex at a temperature at which said heteroduplex is denatured to form an RNA single strand and a first cDNA single strand without completely inactivating the DNA polymerase activity of said enzyme system; e) permitting the second primer to hybridize with the first cDNA strand, followed by synthesis of a second cDNA strand to form a double-stranded cDNA; and f) denaturing the double-stranded cDNA and subjecting the cDNA strands to a sufficient number of amplification cycles to obtain a desired amount of amplified product; wherein after step a), all steps are performed without subsequent addition of any ingredients.
38. The method of claim 37 , wherein said RNA to be amplified contains or is capable of containing secondary structure.
39. The method of claim 37 , wherein, after step a), the container is closed and the container remains closed until the desired amount of amplified product is obtained.
40. The method of claim 37 , wherein said enzyme system comprises at least one first enzyme having reverse transcriptase activity and at least one second enzyme having DNA polymerase activity.
41. The method of claim 40 , wherein said at least one first enzyme comprises at least one enzyme selected from the group consisting of RT-AMV and RT-MMuLV.
42. The method of claim 40 , wherein said at least one first enzyme comprises RT-AMV and said at least one second enzyme comprises Taq polymerase.
43. The method of claim 37 , wherein said first cDNA strand is synthesized and said RNA-cDNA heteroduplex is formed at a temperature from about 50 ° C. to about 75 ° C.
44. The method of claim 37 , wherein said temperature at which said heteroduplex is denatured is above 90 ° C.
45. The method of claim 37 , wherein the second primer is permitted to hybridize with the first cDNA single strand at a temperature form about 50 ° C. to about 80 ° C.
46. The method of claim 37 , wherein said synthesis of said second cDNA occurs at a temperature from about 50 ° C. to about 80 ° C.
47. The method of claim 37 , wherein said first cDNA strand is synthesized and said RNA-cDNA heteroduplex is formed at a temperature from about 45 ° C. to about 75 ° C.
48. The method of claim 47 , wherein said first cDNA strand is synthesized and said RNA-cDNA heteroduplex is formed at a temperature from about 50 ° C. to about 65 ° C.
49. The method of claim 37 , wherein the RNA to be amplified is human immunodeficiency virus RNA.
50. A method for the amplification of RNA in a sample, comprising:
a) obtaining a starting solution by placing, in a container, the sample, a buffer, a first primer, a second primer, a plurality of nucleoside triphosphates, and an enzyme system having reverse transcriptase activity and DNA polymerase activity, wherein the ratio of units of reverse transcriptase activity to units of DNA polymerase activity is 2 to 8 ; b) heat treating said solution at a temperature sufficient to permit denaturation of secondary structures that may be present in said RNA but not above 75 ° C., for a time sufficient to permit denaturation of secondary structures without completely inactiviting the reverse transciptase and DNA polymerase activities of said enzyme system; c) permitting the first primer to hybridize with the RNA in said solution, followed by synthesis, at a temperature from 45 ° to 75 ° C., of a first cDNA strand, thus forming an RNA-cDNA heteroduplex; d) heat treating the solution containing said RNA-cDNA heteroduplex at a temperature at which said heteroduplex is denatured to form an RNA single strand and a first cDNA single strand without completely inactivating the DNA polymerase activity of said enzyme system; e) permitting the second primer to hybridize with the first cDNA strand, followed by synthesis of a second cDNA strand to form a double- stranded cDNA; and f) denaturing the double-stranded cDNA to form cDNA single strands and subjecting the cDNA single strands to a sufficient number of amplification cycles to obtain a desired amount of amplified product; wherein after step a), all steps are performed without subsequent addition of any ingredients.
51. The method of claim 50 , wherein said enzyme system comprises a first enzyme having reverse transcriptase activity and a second enzyme having DNA polymerase activity.
52. The method of claim 50 , wherein the RNA to be amplified is human immunodeficiency virus RNA.
53. The method of claim 1 , wherein the RNA to be amplified is human immunodeficiency vrius RNA.Join the waitlist — get patent alerts
Track USRE39031E — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.