USRE38352EExpiredUtility

Polymerase chain reaction assays for monitoring antiviral therapy and making therapeutic decisions in the treatment of acquired immunodeficiency syndrome

Assignee: UNIV LELAND STANFORD JUNIORPriority: May 14, 1992Filed: Sep 5, 2002Granted: Dec 16, 2003
Est. expiryMay 14, 2012(expired)· nominal 20-yr term from priority
C12Q 1/703C12Q 2600/106C12Q 2600/156
87
PatentIndex Score
13
Cited by
61
References
45
Claims

Abstract

The present invention relates to methods of monitoring, via polymerase chain reaction, the clinical progression of human immunodeficiency virus infection and its response to antiretroviral therapy. According to the invention, polymerase chain reaction assays may be used to predict immunological decline and to identify, at an early stage, patients whose infection has become resistant to a particular antiretroviral drug regimen.

Claims

exact text as granted — not AI-modified
What is claimed is:  
     
       1. A method of evaluating the effectiveness of antiretroviral therapy of an HIV-infected patient comprising: 
       (i) collecting a plasma sample from an HIV-infected patient; and  
       (ii) determining whether the plasma sample comprises nucleic acid encoding HIV reverse transcriptase having a mutation at codons  codon  215 or  74, or codons 215 and 74 , in which the presence of the mutations  mutation correlates positively with an accelerated immunologic decline of said patient compared to patients who do not have the mutations  mutation.  
     
     
       2. The method of  claim 1  in which the mutation at codon 215, 74, or 215 and 74 are  is determined by a method comprising polymerase chain reaction (PCR). 
     
     
       3. The method of  claim 2  which comprises a “nested” polymerase chain reaction. 
     
     
       4. The method of  claim 2  which utilizes primer B (5′-GGATGGAAAGGATCACC-3′)(SEQ ID NO:9). 
     
     
       5. The method of  claim 2  which utilizes primer 3M (3′-AAGTGTGGTCTGTTTTTTGTA-5′)(SEQ ID NO:11). 
     
     
       6. The method of  claim 2  which utilizes primer 74WT (5′-AAGTTCTCTGAAATCTACTTA-3′)(SEQ ID NO:5). 
     
     
       7. The method of  claim 2  which utilizes primer 74MUT (5′-AAGTTCTCTGAAATCTACTTC-3′)(SEQ ID NO:6). 
     
     
       8. The method of  claim 2  which utilizes primer X2 (5′-AACAATGGCCATTGACAGA-3′)(SEQ ID NO:4). 
     
     
       9. The method of  claim 1  in which the antiretroviral agent  therapy being evaluated comprises zidovudine. 
     
     
       10. The method of  claim 1  in which the antiretroviral agent  therapy being evaluated comprises didanosine. 
     
     
       11. The method of  claim 2  wherein PCR is repeated for 30 to 40 cycles. 
     
     
       12. The method of  claim 11  wherein PCR is repeated for 30-35 cycles. 
     
     
       13. A method of evaluating the effectiveness of antiretroviral therapy of an HIV-infected patient comprising: 
       (i) collecting PBMC from an HIV-infected patient; and  
       (ii) determining whether the PBMC comprise proviral HIV DNA which comprises a mutation at codons 74 or  codon 215, or codons 215 and 74,  of the HIV reverse transcriptase gene, in which the presence of the mutations  mutation correlates positively with an accelerated immunologic decline of said patient compared with patients who do not have the mutations  mutation.  
     
     
       14. The method of  claim 13  in which the mutations  mutation at codons 74 or  codon 215, or 215 and 74 are  is determined by a method comprising polymerase chain reaction. 
     
     
       15. The method of  claim 14  which comprises a nested polymerase chain reaction. 
     
     
       16. A method of evaluating the effectiveness of antiretroviral therapy of an HIV- infected patient comprising:    
       ( i )  collecting a plasma sample from an HIV - infected patient; and    
       ( ii )  determining whether the plasma sample comprises nucleic acid encoding HIV reverse transcriptase having a mutation at codon  74 , in which the presence of the mutation correlates positively with an accelerated immunologic decline of said patient compared to patients who do not have the mutation.   
     
     
       17. The method of  claim 16  in which the mutation at codon  74 , is determined by a method comprising polymerase chain reaction ( PCR ). 
     
     
       18. The method of  claim 17  which comprises a “nested” polymerase chain reaction. 
     
     
       19. The method of  claim 17  which utilizes primer B (   5 ′ - GGATGGAAAGGATCACC -   3   ′)( SEQ ID NO: 9   ). 
     
     
       20. The method of  claim 17  which utilizes primer  3 M (   3   ′- AAGTGTGGTCTGTTTTTTGTA -   5   ′)( SEQ ID NO: 11   ). 
     
     
       21. The method of  claim 17  which utilizes primer  74 WT (   5   ′- AAGTTCTCTGAAATCTACTTA -   3   ′)( SEQ ID NO: 5   ). 
     
     
       22. The method of  claim 17  which utilizes primer  74 MUT (   5   ′- AAGTTCTCTGAAATCTACTTC -   3   ′)( SEQ ID NO: 6   ). 
     
     
       23. The method of  claim 17  which utilizes primer X 2 (   5   ′- AACAATGGCCATTGACAGA -   3   ′)( SEQ ID NO: 4   ). 
     
     
       24. The method of  claim 16  in which the antiretroviral therapy being evaluated comprises zidovudine. 
     
     
       25. The method of  claim 16  in which the antiretroviral therapy being evaluated comprises didanosine. 
     
     
       26. The method of  claim 17  wherein PCR is repeated for  30  to  40  cycles. 
     
     
       27. The method of  claim 26  wherein PCR is repeated for  30 - 35  cycles. 
     
     
       28. A method of evaluating the effectiveness of antiretroviral therapy of an HIV- infected patient comprising:    
       ( i )  collecting a plasma sample from an HIV - infected patient; and    
       ( ii )  determining whether the plasma sample comprises nucleic acid encoding HIV reverse transcriptase having a mutation at codons  215  and  74 , in which the presence of the mutation correlates positively with an accelerated immunologic decline of said patient compared to patients who do not have the mutation.   
     
     
       29. The method of  claim 28  in which the mutation at codons  215  and  74  is determined by a method comprising polymerase chain reaction ( PCR ). 
     
     
       30. The method of  claim 29  which comprises a “nested” polymerase chain reaction. 
     
     
       31. The method of  claim 29  which utilizes primer B (   5 ′ - GGATGGAAAGGATCACC -   3   ′)( SEQ ID NO: 9   ). 
     
     
       32. The method of  claim 29  which utilizes primer  3 M (   3   ′- AAGTGTGGTCTGTTTTTTGTA -   5   ′)( SEQ ID NO: 11   ). 
     
     
       33. The method of  claim 29  which utilizes primer  74 WT (   5   ′- AAGTTCTCTGAAATCTACTTA -   3   ′)( SEQ ID NO: 5   ). 
     
     
       34. The method of  claim 29  which utilizes primer  74 MUT (   5   ′- AAGTTCTCTGAAATCTACTTC -   3   ′)( SEQ ID NO: 6   ). 
     
     
       35. The method of  claim 29  which utilizes primer X 2 (   5   ′- AACAATGGCCATTGACAGA -   3   ′)( SEQ ID NO: 4   ). 
     
     
       36. The method of  claim 28  in which the antiretroviral therapy being evaluated comprises zidovudine. 
     
     
       37. The method of  claim 28  in which the antiretroviral therapy being evaluated comprises didanosine. 
     
     
       38. The method of  claim 29  wherein PCR is repeated for  30  to  40  cycles. 
     
     
       39. The method of  claim 38  wherein PCR is repeated for  30 - 35  cycles. 
     
     
       40. A method of evaluating the effectiveness of antiretroviral therapy of an HIV- infected patient comprising:    
       ( i )  collecting PBMC from an HIV - infected patient; and    
       ( ii )  determining whether the PBMC comprise proviral HIV DNA which comprises a mutation at codon  74  of the HIV reverse transcriptase gene, in which the presence of the mutation correlates positively with an accelerated immunologic decline of said patient compared with patients who do not have the mutation.   
     
     
       41. The method of  claim 40  in which the mutation at codon  74  is determined by a method comprising polymerase chain reaction. 
     
     
       42. The method of  claim 41  which comprises a nested polymerase chain reaction. 
     
     
       43. A method of evaluating the effectiveness of antiretroviral therapy of an HIV- infected patient comprising:    
       ( i )  collecting PBMC from an HIV - infected patient; and    
       ( ii )  determining whether the PBMC comprise proviral HIV DNA which comprises a mutation at codons  215  and  74 , of the HIV reverse transcriptase gene, in which the presence of the mutation correlates positively with an accelerated immunologic decline of said patient compared with patients who do not have the mutation.   
     
     
       44. The method of  claim 43  in which the mutation at codons  215  and  74  is determined by a method comprising polymerase chain reaction. 
     
     
       45. The method of  claim 44  which comprises a nested polymerase chain reaction.

Join the waitlist — get patent alerts

Track USRE38352E — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.