US7271156B2ExpiredUtilityA1
Immunostimulatory nucleic acids
Est. expirySep 25, 2019(expired)· nominal 20-yr term from priority
A61P 37/00A61P 37/08A61P 37/04A61P 31/04A61P 31/12A61P 31/00A61P 25/00A61P 27/02A61P 35/00A61P 1/18A61P 13/12A61P 1/00A61P 19/00A61P 15/00A61P 1/16A61P 11/00A61P 11/06A61P 17/00A61K 31/7105A61K 31/7088A61K 39/39A61K 2039/55561A61K 31/7125A61K 45/06
94
PatentIndex Score
119
Cited by
168
References
33
Claims
Abstract
The invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. The T-rich nucleic acids contain poly T sequences and/or have greater than 25% T nucleotide residues. The TG nucleic acids have TG dinucleotides. The C-rich nucleic acids have at least one poly-C region and/ore greater than 50% c nucleotides. These immunostimulatory nucleic acids function in a similar manner to nucleic acids containing CpG motifs. The invention also encompasses preferred CpG nucleic acids.
Claims
exact text as granted — not AI-modified1. A composition comprising
an immunostimulatory nucleic acid comprising
5′ TCGTCGTTTTGACGTTTTGTCGTT 3′ (SEQ ID NO:343).
2. The composition of claim 1 , wherein the immunostimulatory nucleic acid consists of SEQ ID NO:343.
3. The composition of claim 1 , wherein the immunostimulatory nucleic acid is equal to or less than 100 nucleotides in length.
4. The composition of claim 1 , further comprising a pharmaceutically acceptable carrier.
5. The composition of claim 1 , wherein the immunostimulatory nucleic acid is a T-rich immunostimulatory nucleic acid.
6. The composition of claim 1 , wherein the immunostimulatory nucleic acid comprises at least three poly T motifs.
7. The composition of claim 6 , wherein at least one poly T nucleic acid motif comprises
5′ X 1 X 2 TTTTX 3 X 4 3′
wherein X 1 , X 2 , X 3 and X 4 are nucleotides, and X 1 X 2 is selected from the group consisting of TT, TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC, and X 3 X 4 is selected from the group consisting of TT, TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC.
8. The composition of claim 6 , wherein the immunostimulatory nucleic acid comprises at least 4, at least 5, at least 6, at least 7, or at least 8 poly T motifs.
9. The composition of claim 6 , wherein at least two of the at least three poly T motifs each comprises a motif selected from the group consisting of at least five contiguous T nucleotide residues and at least six contiguous T nucleotide residues.
10. The composition of claim 6 , wherein at least three poly T motifs each comprises at least five contiguous T nucleotide residues.
11. The composition of claim 6 , wherein the at least three poly T motifs is at least four motifs.
12. The composition of claim 1 , wherein the immunostimulatory nucleic acid comprises a nucleotide composition selected from the group consisting of greater than 25% T, greater than 35% T, greater than 40% T, greater than 50% T, greater than 60% T, greater than 80% T, greater than 25% C, and greater than 25% A.
13. The composition of claim 1 , wherein the immunostimulatory nucleic acid comprises a length selected from the group consisting of at least 27 nucleotides and at least 30 nucleotides.
14. The composition of claim 1 , wherein the immunostimulatory nucleic acid has a niicleotide backbone that includes at least one backbone modification.
15. The composition of claim 14 , wherein the backbone modification is a phosphorothioate modification.
16. The composition of claim 14 , wherein the nucleotide backbone is chimeric.
17. The composition of claim 14 , wherein the nucleotide backbone is entirely modified.
18. The composition of claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery by a route selected from the group consisting of oral, nasal, rectal, vaginal, and ocular.
19. The composition of claim 1 , wherein the immunostimulatory nucleic acid is provided in a sustained release device.
20. The composition of claim 19 , wherein the sustained release device is a microparticle.
21. The composition of claim 1 , wherein the immunostimulatory nucleic acid is formulated in a delivery device selected from the group consisting of a capsule, a pill, and a sublingual tablet.
22. The composition of claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery locally or systemically.
23. The composition of claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery mucosally.
24. The composition of claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to induce an immune response in a non-rodent subject.
25. The composition of claim 24 , wherein the non-rodent subject is selected from the group consisting of a human, a dog, a cat, a horse, a cow, a pig, a sheep, a goat, a chicken, a monkey, and a fish.
26. The composition of claim 24 , wherein the immune response is selected from the group consisting of a local immune response, a systemic immune response, a mucosal immune response, an antigen specific immune response, and an innate immune response.
27. The composition of claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to treat asthma in a subject in need thereof.
28. The composition of claim 27 , further comprising an asthma medicament.
29. The composition of claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to treat allergy in a subject in need thereof.
30. The composition of claim 29 , further comprising an allergy medicament.
31. The composition of claim 1 , wherein the immunostimulatory nucleic acid comprises
5′ N 1 X 1 X 2 TGX 3 X 4 N 2 3′
wherein X 1 X 2 are nucleotides selected from the group consisting of GT, GG, GA, AA, AT, AG, CT, CA, CG, TA and TT, and X 3 X 4 are nucleotides selected from the group consisting of TT, TC, TG, TA, CT, CG, CC, CA, AC, AT, AG and AA, and N 1 and N 2 are nucleic acid sequences composed of any number of nucleotides provided that the sum total of N 1 and N 2 is in the range of 9 to 19.
32. A method of stimulating an immune response, comprising
administering the composition of claim 1 , to a non-rodent subject in an amount effective to induce an immune response in the non-rodent subject, wherein the non-rodent subject has asthma or allergy.
33. The composition of claim 22 , wherein the nucleotide backbone is entirely phosphorothioate.Join the waitlist — get patent alerts
Track US7271156B2 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.