US7271156B2ExpiredUtilityA1

Immunostimulatory nucleic acids

Assignee: COLEY PHARM GMBHPriority: Sep 25, 1999Filed: Dec 9, 2002Granted: Sep 18, 2007
Est. expirySep 25, 2019(expired)· nominal 20-yr term from priority
A61P 37/00A61P 37/08A61P 37/04A61P 31/04A61P 31/12A61P 31/00A61P 25/00A61P 27/02A61P 35/00A61P 1/18A61P 13/12A61P 1/00A61P 19/00A61P 15/00A61P 1/16A61P 11/00A61P 11/06A61P 17/00A61K 31/7105A61K 31/7088A61K 39/39A61K 2039/55561A61K 31/7125A61K 45/06
94
PatentIndex Score
119
Cited by
168
References
33
Claims

Abstract

The invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. The T-rich nucleic acids contain poly T sequences and/or have greater than 25% T nucleotide residues. The TG nucleic acids have TG dinucleotides. The C-rich nucleic acids have at least one poly-C region and/ore greater than 50% c nucleotides. These immunostimulatory nucleic acids function in a similar manner to nucleic acids containing CpG motifs. The invention also encompasses preferred CpG nucleic acids.

Claims

exact text as granted — not AI-modified
1. A composition comprising
 an immunostimulatory nucleic acid comprising
   5′ TCGTCGTTTTGACGTTTTGTCGTT 3′ (SEQ ID NO:343). 
 
 
     
     
       2. The composition of  claim 1 , wherein the immunostimulatory nucleic acid consists of SEQ ID NO:343. 
     
     
       3. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is equal to or less than 100 nucleotides in length. 
     
     
       4. The composition of  claim 1 , further comprising a pharmaceutically acceptable carrier. 
     
     
       5. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is a T-rich immunostimulatory nucleic acid. 
     
     
       6. The composition of  claim 1 , wherein the immunostimulatory nucleic acid comprises at least three poly T motifs. 
     
     
       7. The composition of  claim 6 , wherein at least one poly T nucleic acid motif comprises
   5′ X 1 X 2 TTTTX 3  X 4  3′ 
 
       wherein X 1 , X 2 , X 3  and X 4  are nucleotides, and X 1 X 2  is selected from the group consisting of TT, TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC, and X 3  X 4  is selected from the group consisting of TT, TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC. 
     
     
       8. The composition of  claim 6 , wherein the immunostimulatory nucleic acid comprises at least 4, at least 5, at least 6, at least 7, or at least 8 poly T motifs. 
     
     
       9. The composition of  claim 6 , wherein at least two of the at least three poly T motifs each comprises a motif selected from the group consisting of at least five contiguous T nucleotide residues and at least six contiguous T nucleotide residues. 
     
     
       10. The composition of  claim 6 , wherein at least three poly T motifs each comprises at least five contiguous T nucleotide residues. 
     
     
       11. The composition of  claim 6 , wherein the at least three poly T motifs is at least four motifs. 
     
     
       12. The composition of  claim 1 , wherein the immunostimulatory nucleic acid comprises a nucleotide composition selected from the group consisting of greater than 25% T, greater than 35% T, greater than 40% T, greater than 50% T, greater than 60% T, greater than 80% T, greater than 25% C, and greater than 25% A. 
     
     
       13. The composition of  claim 1 , wherein the immunostimulatory nucleic acid comprises a length selected from the group consisting of at least 27 nucleotides and at least 30 nucleotides. 
     
     
       14. The composition of  claim 1 , wherein the immunostimulatory nucleic acid has a niicleotide backbone that includes at least one backbone modification. 
     
     
       15. The composition of  claim 14 , wherein the backbone modification is a phosphorothioate modification. 
     
     
       16. The composition of  claim 14 , wherein the nucleotide backbone is chimeric. 
     
     
       17. The composition of  claim 14 , wherein the nucleotide backbone is entirely modified. 
     
     
       18. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery by a route selected from the group consisting of oral, nasal, rectal, vaginal, and ocular. 
     
     
       19. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is provided in a sustained release device. 
     
     
       20. The composition of  claim 19 , wherein the sustained release device is a microparticle. 
     
     
       21. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is formulated in a delivery device selected from the group consisting of a capsule, a pill, and a sublingual tablet. 
     
     
       22. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery locally or systemically. 
     
     
       23. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery mucosally. 
     
     
       24. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to induce an immune response in a non-rodent subject. 
     
     
       25. The composition of  claim 24 , wherein the non-rodent subject is selected from the group consisting of a human, a dog, a cat, a horse, a cow, a pig, a sheep, a goat, a chicken, a monkey, and a fish. 
     
     
       26. The composition of  claim 24 , wherein the immune response is selected from the group consisting of a local immune response, a systemic immune response, a mucosal immune response, an antigen specific immune response, and an innate immune response. 
     
     
       27. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to treat asthma in a subject in need thereof. 
     
     
       28. The composition of  claim 27 , further comprising an asthma medicament. 
     
     
       29. The composition of  claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to treat allergy in a subject in need thereof. 
     
     
       30. The composition of  claim 29 , further comprising an allergy medicament. 
     
     
       31. The composition of  claim 1 , wherein the immunostimulatory nucleic acid comprises
   5′ N 1 X 1 X 2 TGX 3 X 4 N 2  3′ 
 wherein X 1 X 2  are nucleotides selected from the group consisting of GT, GG, GA, AA, AT, AG, CT, CA, CG, TA and TT, and X 3 X 4  are nucleotides selected from the group consisting of TT, TC, TG, TA, CT, CG, CC, CA, AC, AT, AG and AA, and N 1  and N 2  are nucleic acid sequences composed of any number of nucleotides provided that the sum total of N 1  and N 2  is in the range of 9 to 19. 
 
     
     
       32. A method of stimulating an immune response, comprising
 administering the composition of  claim 1 , to a non-rodent subject in an amount effective to induce an immune response in the non-rodent subject, wherein the non-rodent subject has asthma or allergy. 
 
     
     
       33. The composition of  claim 22 , wherein the nucleotide backbone is entirely phosphorothioate.

Join the waitlist — get patent alerts

Track US7271156B2 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.