US5738987AExpiredUtility
16S ribosomal nucleic acid probes to streptococcus pneumoniae
Est. expirySep 4, 2011(expired)· nominal 20-yr term from priority
Inventors:Curt L. Milliman
C12Q 1/689
39
PatentIndex Score
4
Cited by
91
References
24
Claims
Abstract
16S ribosomal nucleic acid hybridization assay probes specific for Streptococcus pneumoniae and no other Streptococcus species.
Claims
exact text as granted — not AI-modifiedI claim:
1. A nucleic acid hybridization assay probe up to 100 nucleotides in length comprising a nucleotide base sequence sufficiently complementary to hybridize to a Streptococcus pneumoniae nucleic acid target region to form a detectable target:probe hybrid under high stringency hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, the nucleotide position 616-638 of E. coli 16S rRNA, wherein under said conditions said probe does not hybridize to nucleic acid from Streptococcus salivarius, Streptococcus agalactiae or Streptococcus bovis, to form a detectable probe:non-target hybrid.
2. A nucleic acid hybridization assay probe 15 to 100 bases in length comprising an oligonucleotide which hybridizes to a Streptococcus pneumoniae nucleic acid target region to form a detectable target:probe hybrid under high stringency hybridization assay conditions, said oligonucleotide comprising at least 14 out of 17 consecutive bases complementary to a target sequence present in said target region, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, the nucleotide position 616-638 of E. coli 16S rRNA, wherein said probe does not hybridize to nucleic acid from Streptococcus salivarius, Streptococcus agalactiae or Streptococcus bovis, to form a detectable probe:non-target hybrid under said conditions.
3. The probe of claim 2, wherein said oligonucleotide comprises 17 out of 17 contiguous nucleotides perfectly complementary to said target sequence.
4. The probe of claim 2, wherein said oligonucleotide comprises a nucleic acid sequence selected from the group consisting of: 5' CAAAGCCTACTATGGTTAAGCC (SEQ ID NO: 1), 5' CAAAGCCUACUAUGGUUAAGCC (SEQ ID NO: 4), 5' GGCTTAACCATAGTAGGCTTTG (SEQ ID NO: 5), and 5' GGCUUAACCAUAGUAGGCUUUG (SEQ ID NO: 6).
5. The probe of claim 4, wherein said probe is 22-50 nucleotides in length.
6. The probe of claim 5, wherein said oligonucleotide consists of said nucleic acid sequence.
7. The probe of claim 6, wherein said oligonucleotide is labeled with a detectable moiety.
8. The probe of claim 7, wherein said detectable moiety is selected from the group consisting of: radioisotope, chemiluminescent molecule, fluorescent molecule, enzyme, cofactor, enzyme substrate, and hapten.
9. The probe of claim 8, wherein said detectable moiety is an acridinium ester.
10. A nucleic acid hybrid comprising: a) a nucleic acid hybridization assay probe 15 to 100 bases in length comprising an oligonucleotide which hybridizes to a Streptococcus pneumoniae nucleic acid target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, the nucleotide position 616-638 of E. coli 16S rRNA, to form a detectable target:probe hybrid under high stringency hybridization assay conditions, said oligonucleotide comprising at least 14 out of 17 consecutive bases complementary to a target sequence present in said target region, wherein said target region has a sequence selected from the group consisting of; 5' CAAAGCCTACTATGGTTAAGCC (SEQ ID NO: 1), and 5' GGCUUAACCAUAGUAGGCUUUG (SEQ ID NO: 6); wherein said probe does not hybridize to nucleic acid from Streptococcus salivarius, Streptococcus agalactiae or Streptococcus bovis, to form a detectable probe:non-target hybrid under said conditions; and b) Streptococcus pneumoniae nucleic acid comprising nucleic acid corresponding to the nucleotide position 616-638 of E. coli 16S rRNA or rDNA.
11. The nucleic acid hybrid of claim 10, wherein said probe is 22 to 50 nucleotides in length and comprises a nucleic acid sequence selected from the group consisting of: 5' CAAAGCCTACTATGGTTAAGCC (SEQ ID NO: 1), 5' CAAAGCCUACUAUGGUUAAGCC (SEQ IU NO: 4) , 5' GGCTTAACCATAGTAGGCTTTG (SEQ ID NO: 5), and 5' GGCUUAACCAUAGUAGGCUUUG (SEQ ID NO: 6).
12. The nucleic acid hybrid of claim 11, wherein said oligonucleotide consists of said nucleic acid sequence.
13. A probe mix comprising: a) a nucleic acid hybridization assay probe 15 to 100 bases in length comprising an oligonucleotide which hybridizes to a Streptococcus pneumoniae nucleic acid target region to form a detectable target:probe hybrid under high stringency hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, the nucleotide position 616-638 of E. coli 16S rRNA, wherein said oligonucleotide comprises a sequence of 14 out of 17 consecutive bases complementary to a hybridization assay probe target sequence selected from the group consisting of; 5' CAAAGCCTACTATGGTTAAGCC (SEQ ID NO: 1), and 5' GGCUUAACCAUAGUAGGCUUUG (SEQ ID NO: 6), wherein said probe does not hybridize to nucleic acid from Streptococcus salivarius, streptococcus agalactiae or Streptococcus bovis, to form a detectable probe:non-target hybrid under said conditions; and b) a helper probe comprising a sequence selected from the group consisting of: SEQ ID No: 2: ACAGCCTTTA ACTTCAGACT TATCTAACCG CCTGCGC, SEQ ID No: 3: TCTCCCCTCT TGCACTCAAG TTAAACAGTT TC, and the sequences perfectly complementary thereto.
14. The probe mix of claim 13, wherein said oligonucleotide has at least 14 out of 17 consecutive bases perfectly complementary to 5' GGCUUAACCAUAGUAGGCUUUG (SEQ ID NO: 6); and said helper probe comprises a helper probe sequence selected from the group consisting of: SEQ ID No: 2: ACAGCCTTTA ACTTCAGACT TATCTAACCG CCTGCGC; and SEQ ID No: 3: TCTCCCCTCT TGCACTCAAG TTAAACAGTT TC.
15. The probe mix of claim 14, wherein said hybridization assay probe sequence comprises the hybridization assay probe sequence 5' CAAAGCCTACTATGGTTAAGCC (SEQ ID NO: 1).
16. The probe mix of claim 15, wherein said hybridization assay probe consists of said hybridization assay probe sequence and said helper probe consists of said helper probe sequence.
17. A method for determining whether Streptococcus pneumoniae may be present in a sample comprising the steps of: a) providing to said sample a nucleic acid hybridization assay probe comprising a nucleotide base sequence region which hybridizes to a Streptococcus pneumoniae nucleic acid target region to form a detectable target:probe hybrid under high stringency hybridization assay conditions, said nucleotide base sequence region comprising at least 14 out of 17 consecutive bases complementary to a target sequence present in said target region, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, the nucleotide position 616-638 of E. coli 16S rRNA, wherein said probe does not hybridize to nucleic acid from Streptococcus salivarius, Streptococcus agalactiae or Streptococcus bovis, to form a detectable probe:non-target hybrid under said conditions, and b) detecting whether said probe hybridizes to nucleic acid present in said sample under said hybridization conditions as an indication that Streptococcus pneumoniae may be present in said sample.
18. The method of claim 17, wherein said oligonucleotide comprises 17 out of 17 contiguous nucleotides perfectly complementary to said target sequence.
19. The method of claim 17, wherein said probe comprises a nucleic acid sequence selected from the group consisting of: 5' CAAAGCCTACTATGGTTAAGCC (SEQ ID NO: 1), 5' CAAAGCCUACUAUGGUUAAGCC (SEQ ID NO: 4), 5' GGCTTAACCATAGTAGGCTTTG (SEQ ID NO: 5), and 5' GGCUUAACCAUAGUAGGCUUUG (SEQ ID NO: 6).
20. The method of claim 19, wherein said probe is 22-50 nucleotides in length.
21. A method for determining whether Streptococcus pneumoniae may be present in a sample comprising the steps of: a) providing to said sample a nucleic acid hybridization assay probe consisting of a nucleic acid sequence selected from the group consisting of: 5' CAAAGCCTACTATGGTTAAGCC (SEQ ID NO; 1), 5' CAAAGCCUACUAUGGUUAAGCC (SEQ ID NO; 4), 5' GGCTTAACCATAGTAGGCTTTG (SEQ ID NO: 5), and 5' GGCUUAACCAUAGUAGGCUUUG (SEQ ID NO: 6); and b) detecting whether said probe hybridizes to nucleic acid present in said sample under hybridizations conditions wherein said probe does not hybridize to nucleic acid from Streptococcus salivarius, Streptococcus agalactiae or Streptococcus bovis to form a detectable probe:non-target hybrid, as an indication that Streptococcus pneumoniae may be present in said sample.
22. The method of claim 21, wherein said probe is labeled with a detectable moiety.
23. The method of claim 22, wherein said detectable moiety is selected from the group consisting of: radioisotope, chemiluminescent molecule, fluorescent molecule, enzyme, cofactor, enzyme substrate, and hapten.
24. The method of claim 23, wherein said detectable moiety is an acridinium ester.Join the waitlist — get patent alerts
Track US5738987A — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.