Bovine respiratory syncytial virus detection and primers

Abstract

The use of specific primers and a probe in a reverse transcriptase-polymerase chain reaction provides a method for specifically identifying bovine respiratory syncytial virus in cattle.

We claim: 
     
       1. A method to detect Bovine Respiratory Syncytial Virus (BRSV) from infected tissues comprising performing primer specific RNA transcription based amplication and nucleic acid hybridization comprising specifically reverse transcribing a portion of the Bovine Respiratory Syncytial Virus fusion protein messenger ribonucleic acid (BRSV F protein mRNA) is specifically reverse transcribed into DNA and amplifying said DNA with primers consisting of the following two single oligonucleotides having the DNA sequences: TTACCACACCCCTCAGTACA (Sequence Id. No. 1) and   CATTGTGTCACAGAACACTC (Sequence Id. No. 2), and following said amplification, hybridizing a single strand oligonucleotide probe consisting of the oligonucleotide having the DNA sequence GTGGTCAAAGAAGAGGTCAT (Sequence Id. No. 3) to said amplification product and detecting said hybridized probe, wherein A is adenosine, T is thymidine, G is guanosine, and C is cytosine, the sequence being in the 5' to 3' orientation.   
     
     
       2. A synthetic oligonucleotide used in detecting Bovine Respiratory Syncytial Virus (BRSV) from infected tissues by polymerase chain reaction wherein said oligonucleotide has the DNA sequence consisting of: TTACCACACCCCTCAGTACA (Sequence Id. No. 1), wherein A is adenosine, T is thymidine, G is guanosine, and C is cytosine, the sequence being in the 5' to 3' orientation. 
     
     
       3. A synthetic aligonucleotide used in detecting Bovine Respiratory Syncytial Virus (BRSV) from infected tissues by polymerase chain reaction wherein said oligonucleotide has the DNA sequence consisting of: CATTGTGTCACAGAACACTC (Sequence Id. No. 2), wherein A is adenosine, T is thymidine, G is guanosine, and C is cytosine, the sequence being in the 5' and 3' orientation.   
     
     
       4. A synthetic oligonucleotide used in detecting Bovine Respiratory Syncytial Virus (BRSV) from infected tissues by polymerase chain reaction wherein the oligonucleotide has the DNA sequence consisting of: GTGGTCAAAGAAGAGGTCAT (Sequence Id. No. 3), wherein A is adenosine, T is thymidine, G is guanosine, and C is cytosine, the sequence being in the 5' to 3' orientation.