Conjugates, and uses thereof

Abstract

Disclosed herein is a conjugate comprising a targeting moiety and a proteolytic moiety. According to some embodiments of the present disclosure, the targeting moiety comprises the nucleic acid of SEQ ID NO: 1, and a first conjugating group; and the proteolytic moiety comprises a ligand of E3 ubiquitin ligase, and a second conjugating group. The targeting moiety is linked to the proteolytic moiety via a click reaction occurred between the first and second conjugating groups. Also disclosed herein are methods of treating diseases by using the instant conjugate.

What is claimed is: 
     
         1 . A conjugate comprising,
 a targeting moiety comprising a nucleic acid, and a first conjugating group linked to the nucleic acid, wherein the nucleic acid comprises the nucleotide sequence of “GGGUUGCGGAGGGUGGGCCU” (SEQ ID NO: 1); and   a proteolytic moiety comprising a ligand of E3 ubiquitin ligase, and a second conjugating group linked to the ligand of E3 ubiquitin ligase;   wherein   the first and second conjugating groups are respectively selected from the group consisting of azide, alkyne, tetrazine, cyclooctene, and cyclooctyne groups; and   the targeting moiety is linked to the proteolytic moiety via copper catalyzed azide-alkyne cycloaddition (CuAAC) reaction or strained-promoted azide-alkyne click chemistry (SPAAC) reaction that occurred between the first conjugating group of the targeting moiety and the second conjugating group of the proteolytic moiety.   
     
     
         2 . The conjugate of  claim 1 , wherein the first conjugating group is a hexynyl group and is linked to the 5′ end of the nucleic acid. 
     
     
         3 . The conjugate of  claim 1 , wherein the proteolytic moiety further comprises a linker linking the second conjugating group to the ligand of E3 ubiquitin ligase. 
     
     
         4 . The conjugate of  claim 3 , wherein the linker comprises 1 to 5 repeats of ethylene glycol (EG) unit. 
     
     
         5 . The conjugate of  claim 1 , wherein the ligand of E3 ubiquitin ligase is (2S,4R)-1-((S)-2-Amino-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (AHPC), or pomalidomide. 
     
     
         6 . The conjugate of  claim 5 , wherein the proteolytic moiety has the structure of formula (I) or formula (II), 
       
         
           
           
               
               
           
         
       
     
     
         7 . The conjugate of  claim 6 , wherein the conjugate has the structure of formula (III) or formula (IV), 
       
         
           
           
               
               
           
         
         wherein X is the nucleic acid. 
       
     
     
         8 . A method of treating Alzheimer's disease (AD) in a subject comprising administering to the subject an effective amount of the conjugate of  claim 1  to alleviate or ameliorate the symptoms associated with the AD. 
     
     
         9 . The method of  claim 8 , wherein the subject is a human. 
     
     
         10 . A method of treating a cancer in a subject comprising administering to the subject an effective amount of the conjugate of  claim 1  to alleviate or ameliorate the symptoms associated with the cancer. 
     
     
         11 . The method of  claim 10 , wherein the subject is a human.