METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF

Abstract

Disclosed herein are methods of treating age-related macular diseases, comprising administering to a subject in need thereof a vector comprising AIMP2-DX2 and optionally a target sequence for miR-142.

1 . A method of treating age-related macular disease (AMD) in a subject in need thereof, comprising administering to the subject a pharmaceutically effective amount of a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene. 
     
     
         2 . The method of  claim 1 , wherein the AMD is wet AMD. 
     
     
         3 . The method of  claim 1 , wherein the AMD is dry AMD. 
     
     
         4 . The method of  claim 1 , wherein the vector further comprises an miR-142 target sequence. 
     
     
         5 . The method of  claim 1 , wherein the vector further comprises a promoter operably linked to the AIMP2-DX2. 
     
     
         6 . The method of  claim 5 , wherein the promoter is a Retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter, Synapsin promoter, MeCP2 promoter, CaMKII promoter, Hb9 promoter, or opsin promoter. 
     
     
         7 . The method of  claim 4 , wherein the miR-142 target sequence is 3′ to the AIMP2-DX2 gene. 
     
     
         8 . The method of  claim 1 , wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20. 
     
     
         9 . The method of  claim 8 , wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20. 
     
     
         10 . The method of  claim 1 , wherein the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO:10 or 11. 
     
     
         11 . The method of  claim 1 , wherein the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:10 or 11. 
     
     
         12 . The method of  claim 4 , wherein the miR-142 target sequence comprises ACACTA. 
     
     
         13 . The method of  claim 4 , wherein the miR-142 target sequence comprises ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO:5. 
     
     
         14 . The method of  claim 4 , wherein the miR-142 target sequence comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO:5 (TCCATAAAGTAGGAAACACTACA). 
     
     
         15 . The method of  claim 14 , wherein the miR-142 target sequence comprises a nucleotide sequence of SEQ ID NO:5. 
     
     
         16 . The method of  claim 4 , wherein the miR-142 target sequence comprises ACTTTA. 
     
     
         17 . The method of  claim 4 , wherein the miR-142 target sequence comprises ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO:7. 
     
     
         18 . The method of  claim 4 , wherein the miR-142 target sequence comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO:7 (AGTAGTGCTTTCTACTTTATG). 
     
     
         19 . The method of  claim 18 , wherein the miR-142 target sequence comprises a nucleotide sequence of SEQ ID NO:7. 
     
     
         20 . The method of  claim 4 , wherein the miR-142 target sequence is repeated 2-10 times. 
     
     
         21 . The method of  claim 1 , wherein the vector is a viral vector. 
     
     
         22 . The method of  claim 21 , wherein the viral vector is an adenovirus, adeno-associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), murine leukemia virus (MLV), avian sarcoma/leukosis (ASLV), spleen necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), vaccinia virus, or Herpes simplex virus vector. 
     
     
         23 . The method of  claim 1 , wherein the recombinant vector is administered topically to, by intravitreal injection to, by subconjunctival injection to, or into a subretinal space of the subject. 
     
     
         24 . The method of  claim 1 , further comprising administering to the subject an additional therapeutic agent. 
     
     
         25 . The method of  claim 24 , wherein the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab.