US2023374501A1PendingUtilityA1
Means and methods for modifying multiple alleles
Est. expiryJun 20, 2036(~9.9 yrs left)· nominal 20-yr term from priority
C12N 15/11C12Y 304/21021C12N 15/102C12N 9/22C12N 9/6437C12P 21/005C12N 2800/80C12N 15/1137C12N 2310/20
69
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
The present invention relates to a method of modifying at least one gene in a cell via CRISPR/Cas, wherein the at least one gene has at least three alleles. The present invention further relates to cells obtainable by the method of the invention. Additionally, the present invention provides a method of producing a protein in a cell obtainable by the method of modifying at least one gene of the invention. Moreover, the invention relates to proteins obtainable by the method of producing a protein and use thereof, for example in therapy.
Claims
exact text as granted — not AI-modified1 . A method of modifying at least one gene in a cell via CRISPR/Cas, wherein the at least one gene has at least three alleles.
2 . The method of claim 1 , wherein at least two genes are modified, wherein at least one of the two genes has at least three alleles.
3 . The method of claim 1 , wherein at least two genes are modified, and wherein a first gene has at least three alleles and a second gene has at least three alleles, preferably four alleles.
4 . The method of claim 1 wherein at least one, two, three, four or all alleles of the at least one gene, preferably of the at least two genes, are modified.
5 . The method of claim 1 , wherein the at least one gene or the at least two genes is/are targeted in at least one, preferably in two, position(s) of the nucleotide sequence of its/their coding and/or regulatory region(s).
6 . The method of claim 1 , wherein the cell is polyploid in at least one gene, preferably in at least one of the genes to be modified.
7 . The method of claim 1 , wherein the cell is diploid, triploid or tetraploid in at least one of the genes.
8 . The method of claim 1 , wherein the cell is triploid in a first gene and tetraploid in a second gene, preferably wherein the first gene and/or the second gene are to be modified.
9 . The method of claim 1 , wherein modifying at least one gene via CRISPR/Cas results in introduction of one or more insertion(s), deletion(s) and/or substitution(s) of one or more nucleotides or a combination thereof in a coding and/or regulatory region of the at least one gene.
10 . The method of claim 1 , wherein modifying at least one gene via CRISPR/Cas results in decreased transcription and/or expression of the least one gene and/or in production of a variant of the at least one gene which is truncated and/or has altered enzymatic activity.
11 . The method according to claim 1 , wherein the cell is a human cell or is derived from a human cell.
12 . The method according to claim 1 , wherein the cell is an immortalized cell.
13 . The method according to claim 1 , wherein for each position to be targeted the CRISPR/Cas system comprises two gRNA plasmids, each gRNA plasmid comprising a specific targeting sequence.
14 . The method according to claim 1 , wherein the at least one gene is B4GALNT3, B4GALNT4 or glutamine synthetase.
15 . The method according to claim 2 , wherein the at least two genes are B4GALNT3 and B4GALNT4, preferably wherein the first gene is B4GALNT3 and the second gene is B4GALNT4.
16 . The method according to claim 15 , wherein B4GALNT3 and B4GALNT4 are each targeted in two positions.
17 . The method according to claim 14 , wherein the targeting sequences specific for B4GALNT3 are selected from ATTGCTGCAGATGACAACG (SEQ ID NO: 1)/TGGATTTTCCCTGGGCAGC (SEQ ID NO: 2) and CCCGGGACACCCTCTATCG (SEQ ID NO: 3)/GGCCGAAGCATGTCAGCGGG (SEQ ID NO: 4); and/or wherein the targeting sequences specific for B4GALNT4 are selected from GCGTGCACTTGTGTATTCG (SEQ ID NO: 5)/CCACAGTCACTCACCGCCT (SEQ ID NO: 6) and GGTTTCATCCACCCGGCGA (SEQ ID NO: 7)/GAGTCCATAGTTCTTCCACT (SEQ ID NO: 8).
18 . A cell obtainable by the method of claim 1 .
19 . A method of producing a protein in a host cell, comprising the steps of:
introducing at least one nucleic acid encoding said protein in a cell according to claim 18 ; culturing said host cell under conditions which permit the production of said protein; thereby producing the protein.
20 . The method of producing a protein according to claim 19 , wherein the protein is a naturally occurring protein, an artificially created protein or a fragment thereof.Join the waitlist — get patent alerts
Track US2023374501A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.