US2023227859A1PendingUtilityA1

Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Assignee: CHARPENTIER EMMANUELLEPriority: May 25, 2012Filed: Nov 10, 2022Published: Jul 20, 2023
Est. expiryMay 25, 2032(~5.8 yrs left)· nominal 20-yr term from priority
H10P 14/6512H10P 14/20H10H 20/0137C12N 9/226C12N 2310/20C12N 15/907A01H 6/4684A01K 67/027A61K 38/465C12N 9/22C12N 15/63C12N 15/70C12N 15/90C12N 15/102C12N 15/111C12N 15/113C12N 15/746C12N 15/902C12Q 1/686H01L 21/02312H01L 33/0075A61K 48/00C12N 2310/11C12N 2310/13C12N 2310/531C12N 2310/3519C12N 2800/80C12Y 301/04A61P 31/00A61P 31/04A61P 31/12A61P 35/00A61P 43/00Y02A50/30C07K 2319/85C07K 2319/71C12N 2310/14C12N 2310/31C12N 2310/32C12N 2310/33C12N 5/10
89
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
         1 . A single-molecule DNA-targeting RNA having the structure: , wherein the linker is GAAA and the nucleotide sequence of the single-molecule DNA-targeting RNA is  
       
         
           
                 
               
                   GAUUUCUUCUUGCGCUUUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAU 
                 
                   AAGGCUAGUCCG (SEQ ID NO: 321) 
                 
             
                
                
               
            
           
         
       
       . 
     
     
         2 . A method of cleaving a target DNA, the method comprising:
 contacting a target DNA with a complex comprising: 
 (a) the single molecule DNA-targeting RNA of  claim 1 ; and 
 (b) a Cas9 protein comprising the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.:2, 
   wherein prior to said contacting the target DNA is double stranded and comprises a nucleotide sequence                taatgaattccccaatacccaaaaagcgcaagaagaaatcaaccagcgca     (SEQ ID NO: 302)                  hybridized to a nucleotide sequence                tgcgctggttgatttcttcttgcgctttttgggtattggggaattcatta     (SEQ ID NO: 301),                  wherein said contacting is in vitro and does not take place inside of a cell, and   wherein the method results in cleavage of the target DNA.

Join the waitlist — get patent alerts

Track US2023227859A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.