Methods and kits for evaluating zinc levels in milk

Abstract

The present invention is directed to methods and kits for determining the presence of a mutated SLC30A2 polynucleotide. The invention is further directed to methods of determining a subject's genetic-susceptibility to zinc deficiency and evaluating zinc levels in a composition comprising breast milk.

1 . A method for reducing the risk of zinc deficiency in a breastfed infant, comprising:
 a. providing a composition comprising breast milk,   b. screening for the presence of a mutation in a SLC30A2 polynucleotide derived from said composition comprising breast milk, wherein determining that said mutation is present in said SLC30A2 polynucleotide indicates that said composition has a low zinc content, and   c. administering zinc to said breastfed infant consuming said composition determined as having low zinc content,   thereby reducing the risk of zinc deficiency in the breastfed infant.   
     
     
         2 . The method of  claim 1 , further comprising diagnosing transient neonatal zinc deficiency (TNZD) in said infant, wherein detection of the presence of said mutation determines said infant is afflicted with TNZD. 
     
     
         3 . The method of  claim 1 , wherein a wildtype SLC30A2 polynucleotide comprises a polynucleotide sequence as set forth in SEQ ID NO: 1. 
     
     
         4 . The method of  claim 1 , wherein said SLC30A2 polynucleotide is a DNA molecule, a mRNA molecule or a cDNA molecule made from said mRNA molecule. 
     
     
         5 . The method of  claim 1 , wherein said mutation reduces stability of said mRNA, reduces translation of said mRNA, reduces the level of ZnT2 protein produced, reduces homodimerization of ZnT2 protein produced, reduces zinc binding by ZnT2 protein produced, reduces zinc transport by ZnT2 protein produced, or a combination thereof. 
     
     
         6 . The method of  claim 1 , wherein said mutation is deletion of bases 840-866. 
     
     
         7 . The method of  claim 1 , wherein said mutation is a missense mutation in ZnT2 protein being selected from the group consisting of: G87R, H106Y, G175W, N214K, G233D, G233R, P245R, E279K, G299R, G299W, and any combination thereof. 
     
     
         8 . The method  claim 1 , wherein said determining comprises sequencing of said polynucleotide. 
     
     
         9 . The method of  claim 8 , wherein said sequencing employs at least one oligonucleotide with at least 70% homology to at least one sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 2) 
                 
                     
                   ACTGCATGGAGGCCAAGGAG, 
                 
                     
                 
                     
                   (SEQ ID NO: 3) 
                 
                     
                   GTCGCCGATCACATGGATG, 
                 
                     
                 
                     
                   (SEQ ID NO: 4) 
                 
                     
                   CTGGTGTACCTGGCTGTGGAG, 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 5) 
                 
                     
                   TGAGCAGTCAGTCTGAGGGGC. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         10 . The method of  claim 8 , wherein said sequencing employs at least one oligonucleotide comprising at least one sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 2) 
                 
                     
                   ACTGCATGGAGGCCAAGGAG, 
                 
                     
                 
                     
                 
                     
                   (SEQ ID NO: 3) 
                 
                     
                   GTCGCCGATCACATGGATG, 
                 
                     
                 
                     
                   (SEQ ID NO: 4) 
                 
                     
                   CTGGTGTACCTGGCTGTGGAG, 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 5) 
                 
                     
                   TGAGCAGTCAGTCTGAGGGGC. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         11 . The method of  claim 1 , wherein said determining comprises PCR analysis of a DNA or a cDNA polynucleotide. 
     
     
         12 . The method of  claim 11 , wherein said PCR analysis employs at least one oligonucleotide with at least 70% homology to at least one sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 6) 
                 
                     
                   GATCCTGGTGTTGATGGATGCT, 
                 
                     
                 
                     
                   (SEQ ID NO: 7) 
                 
                     
                   TGAGCAGTCAGTCTGAGGGGC, 
                 
                     
                 
                     
                   (SEQ ID NO: 8) 
                 
                     
                   CCAAGGGCGTTGACTTCACA, 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 9) 
                 
                     
                   GATGTGGACAGACAGAACAGGCTGG. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         13 . The method of  claim 11 , wherein said PCR analysis employs at least one oligonucleotide comprising at least one sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 6) 
                 
                     
                   GATCCTGGTGTTGATGGATGCT, 
                 
                     
                 
                     
                   (SEQ ID NO: 7) 
                 
                     
                   TGAGCAGTCAGTCTGAGGGGC, 
                 
                     
                 
                     
                   (SEQ ID NO: 8) 
                 
                     
                   CCAAGGGCGTTGACTTCACA, 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 9) 
                 
                     
                   GATGTGGACAGACAGAACAGGCTGG. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         14 . The method of  claim 11 , wherein said PCR analysis employs at least one oligonucleotide with at least 70% homology to said sequence GATCCTGGTGTTGATGGATGCT (SEQ ID NO: 6). 
     
     
         15 . The method of  claim 11 , wherein said PCR analysis employs at least one oligonucleotide with at least 70% homology to said sequence CCAAGGGCGTTGACTTCACA (SEQ ID NO: 8). 
     
     
         16 . A kit for evaluating zinc levels in a composition comprising breast milk, comprising at least one oligonucleotide that specifically hybridizes to a SLC30A2 polynucleotide as set forth in SEQ ID NO: 1. 
     
     
         17 . The kit of  claim 16 , comprising at least one oligonucleotide with at least 70% homology to at least one sequence selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 6) 
                 
                     
                   GATCCTGGTGTTGATGGATGCT, 
                 
                     
                 
                     
                   (SEQ ID NO: 7) 
                 
                     
                   TGAGCAGTCAGTCTGAGGGGC, 
                 
                     
                 
                     
                   (SEQ ID NO: 8) 
                 
                     
                   CCAAGGGCGTTGACTTCACA, 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 9) 
                 
                     
                   GATGTGGACAGACAGAACAGGCTGG. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         18 . The kit of  claim 17 , for diagnosing TNZD in an infant.