Methods and compositions for rna-directed target dna modification and for rna directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

1 . A prokaryotic cell comprising an expression vector comprising a nucleotide sequence encoding a Cas9 protein fused to a hemagglutinin protein tag. 
     
     
         2 . A double-molecule DNA-targeting RNA having the structure: 
       
         
           
                 
                 
               
                                                                                RNA 1 
                     
                 
                                  5′-20-nt targeting seq-GUUUUAGAGCUAUGCUGUUUUG-3’ 
                 
                                                          |||||| ||||                           
                 
                    AGCCACGGUGAAAAGUUCAACUAUUGCCUGAUCGGAAUAAAAUU CGAU-5’ 
                 
                   G |||||||                                   GAA     RNA 2 (23-89) 
                 
                   UCGGUGCUUUUUUU-3’ 
                 
             
                
                
                
                
                
                
               
            
           
         
       
     
     
         3 . A method of cleaving a target DNA, the method comprising:
 contacting a target DNA with:   (a) the double-molecule DNA-targeting RNA of claim  251 , wherein the “20-nt targeting seq” is nnnnnnnnnnnnnnnnnnnn and is a DNA-targeting segment that hybridizes with a target sequence of the target DNA; and   (b) a Cas9 protein comprising the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2,   wherein said contacting does not take place inside of a cell, and   wherein the target DNA is cleaved.   
     
     
         4 . A method of modifying a eukaryotic cell, the method comprising:
 providing to a eukaryotic cell:   (a) a Cas9 protein; and   (b) a single-molecule DNA-targeting RNA comprising, in 5′ to 3′ order:
 a DNA-targeting segment that comprises a 20 nucleotide long targeting sequence that is complementary to and hybridizes with a target sequence in a chromosomal target DNA of the eukaryotic cell; and 
 a protein-binding segment that is about 80 or about 100 nucleotides long, interacts with the Cas9 protein, and comprises two complementary stretches of nucleotides that are covalently linked by intervening nucleotides, wherein said complementary stretches of nucleotides hybridize to one another to form a double stranded RNA duplex, 
   wherein the single-molecule DNA-targeting RNA forms a complex with the Cas9 protein and guides the complex to said target sequence, and the Cas9 protein cleaves the chromosomal target DNA.   
     
     
         5 . A method of modifying a eukaryotic cell, the method comprising:
 providing to a eukaryotic cell:   (a) a Cas9 protein; and   (b) a single-molecule DNA-targeting RNA comprising a 103 nucleotide (nt) sequence that comprises, in 5′ to 3′ order:
 a 20 nucleotide (nt) targeting sequence that is complementary to and hybridizes with a target sequence in a chromosomal target DNA of the eukaryotic cell; 
 a 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 a 4 nt linker sequence GAAA, and 
 a 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUUU (SEQ ID NO: 432), 
   wherein the single-molecule DNA-targeting RNA forms a complex with the Cas9 protein and guides the complex to said target sequence, and the Cas9 protein cleaves the chromosomal target DNA.   
     
     
         6 . The method of  claim 4 , wherein the eukaryotic cell is provided with the single-molecule DNA-targeting RNA by introducing into the eukaryotic cell a nucleic acid encoding the single-molecule DNA-targeting RNA, and wherein the eukaryotic cell is provided with the Cas9 protein by introducing into the eukaryotic cell a nucleic acid encoding the Cas9 protein. 
     
     
         7 . The method of  claim 5 , wherein the eukaryotic cell is provided with the single-molecule DNA-targeting RNA by introducing into the eukaryotic cell a nucleic acid encoding the single-molecule DNA-targeting RNA, and wherein the eukaryotic cell is provided with the Cas9 protein by introducing into the eukaryotic cell a nucleic acid encoding the Cas9 protein. 
     
     
         8 . The method of  claim 6 , wherein the nucleic acid encoding the single-molecule DNA-targeting RNA or the nucleic acid encoding the Cas9 protein is introduced into the cell using a viral vector. 
     
     
         9 . The method of  claim 7 , wherein the nucleic acid encoding the single-molecule DNA-targeting RNA or the nucleic acid encoding the Cas9 protein is introduced into the cell using a viral vector. 
     
     
         10 . The method of  claim 6 , wherein the nucleic acid encoding the single-molecule DNA-targeting RNA or the nucleic acid encoding the Cas9 protein is introduced into the cell using an adeno-associated virus. 
     
     
         11 . The method of  claim 7 , wherein the nucleic acid encoding the single-molecule DNA-targeting RNA or the nucleic acid encoding the Cas9 protein is introduced into the cell using an adeno-associated virus. 
     
     
         12 . The method of  claim 4 , wherein the eukaryotic cell is a yeast cell, a plant cell, a non-human mammalian cell, or a human cell. 
     
     
         13 . The method of  claim 5 , wherein the eukaryotic cell is a yeast cell, a plant cell, a non-human mammalian cell, or a human cell. 
     
     
         14 . The method of  claim 4 , wherein the eukaryotic cell is a human induced pluripotent stem cell. 
     
     
         15 . The method of  claim 5 , wherein the eukaryotic cell is a human induced pluripotent stem cell. 
     
     
         16 . The method of  claim 4 , comprising providing to the eukaryotic cell two or more of said single-molecule DNA-targeting RNAs, wherein the two or more single-molecule DNA-targeting RNAs each hybridize with different target sequences within said chromosomal target DNA. 
     
     
         17 . The method of  claim 5 , comprising providing to the eukaryotic cell two or more of said single-molecule DNA-targeting RNAs, wherein the two or more single-molecule DNA-targeting RNAs each hybridize with different target sequences within said chromosomal target DNA. 
     
     
         18 . The method of  claim 16 , wherein the eukaryotic cell is provided with the two or more single-molecule DNA-targeting RNAs by introducing into the eukaryotic cell nucleic acids encoding them. 
     
     
         19 . The method of  claim 17 , wherein the eukaryotic cell is provided with the two or more single-molecule DNA-targeting RNAs by introducing into the eukaryotic cell nucleic acids encoding them. 
     
     
         20 . The method of  claim 4 , wherein the single-molecule DNA-targeting RNA is expressed in the eukaryotic cell using a human U6 polymerase III promoter. 
     
     
         21 . The method of  claim 5 , wherein the single-molecule DNA-targeting RNA is expressed in the eukaryotic cell using a human U6 polymerase III promoter. 
     
     
         22 . The method of  claim 4 , wherein said providing results in deletion or insertion of sequence from the chromosomal target DNA. 
     
     
         23 . The method of  claim 5 , wherein said providing results in deletion or insertion of sequence from the chromosomal target DNA. 
     
     
         24 . The method of  claim 4 , wherein the Cas9 protein is fused at its carboxyl terminus (C-terminus) to one or more protein transduction domains (PTDs), wherein said one or more PTDs aids in traversal of the Cas9 protein from cytosol to within an organelle. 
     
     
         25 . The method of  claim 5 , wherein the Cas9 protein is fused at its carboxyl terminus (C-terminus) to one or more protein transduction domains (PTDs), wherein said one or more PTDs aids in traversal of the Cas9 protein from cytosol to within an organelle. 
     
     
         26 . The method of  claim 24 , wherein at least one of said one or more PTDs comprises the amino acid sequence YGRKKRRQRRR (SEQ ID NO: 264), RRQRRTSKLMKR (SEQ ID NO: 265), RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         27 . The method of  claim 25 , wherein at least one of said one or more PTDs comprises the amino acid sequence YGRKKRRQRRR (SEQ ID NO: 264), RRQRRTSKLMKR (SEQ ID NO: 265), RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269) 
     
     
         28 . The method of  claim 4 , wherein the Cas9 protein is fused with three C-terminal SV40 nuclear localization sequences. 
     
     
         29 . The method of  claim 5 , wherein the Cas9 protein is fused with three C-terminal SV40 nuclear localization sequences. 
     
     
         30 . The method of  claim 4 , wherein the cleavage of the chromosomal target DNA by the Cas9 protein results in altered expression of the target sequence. 
     
     
         31 . The method of  claim 5 , wherein the cleavage of the chromosomal target DNA by the Cas9 protein results in altered expression of the target sequence. 
     
     
         32 . The method of  claim 4 , wherein the cleavage of the chromosomal target DNA by the Cas9 protein results in nonhomologous end joining. 
     
     
         33 . The method of  claim 5 , wherein the cleavage of the chromosomal target DNA by the Cas9 protein results in nonhomologous end joining. 
     
     
         34 . The method of  claim 4 , further comprising providing a donor polynucleotide to the eukaryotic cell, wherein a sequence of the donor polynucleotide is integrated into the chromosomal target DNA. 
     
     
         35 . The method of  claim 5 , further comprising providing a donor polynucleotide to the eukaryotic cell, wherein a sequence of the donor polynucleotide is integrated into the chromosomal target DNA. 
     
     
         36 . A method of modifying a eukaryotic cell, the method comprising:
 providing to a eukaryotic cell:   (a) a Cas9 protein; and   (b) a first single-molecule DNA-targeting RNA and a second single-molecule DNA-targeting RNA, wherein each single-molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
 a DNA-targeting segment that comprises a 20 nucleotide long targeting sequence; and 
 a protein-binding segment that is about 80 or about 100 nucleotides long, interacts with the Cas9 protein, and comprises two complementary stretches of nucleotides that are covalently linked by intervening nucleotides, wherein said complementary stretches of nucleotides hybridize to one another to form a double stranded RNA duplex, 
   wherein the targeting sequence of the first single-molecule DNA-targeting RNA hybridizes with a first target sequence in a chromosomal target DNA of the eukaryotic cell and the targeting sequence of the second single-molecule DNA-targeting RNA hybridizes with a second target sequence in the chromosomal target DNA, and wherein the Cas9 protein cleaves the chromosomal target DNA at the first and second target sequences, resulting in deletion of an intervening fragment of the chromosomal target DNA.   
     
     
         37 . A method of modifying a eukaryotic cell, the method comprising:
 providing to a eukaryotic cell:   (a) a Cas9 protein; and   (b) a first single-molecule DNA-targeting RNA and a second single-molecule DNA-targeting RNA, wherein each single-molecule DNA-targeting RNA comprises a 103 nucleotide (nt) sequence that comprises, in 5′ to 3′ order:
 a 20 nucleotide (nt) targeting sequence that is complementary to and hybridizes with a target sequence in a chromosomal target DNA of the eukaryotic cell; 
 a 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 a 4 nt linker sequence GAAA, and 
 a 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUUU (SEQ ID NO: 432), 
   wherein the targeting sequence of the first single-molecule DNA-targeting RNA hybridizes with a first target sequence in a chromosomal target DNA of the eukaryotic cell and the targeting sequence of the second single-molecule DNA-targeting RNA hybridizes with a second target sequence in the chromosomal target DNA, and wherein the Cas9 protein cleaves the chromosomal target DNA at the first and second target sequences, resulting in deletion of an intervening fragment of the chromosomal target DNA.   
     
     
         38 . The method of  claim 36 , wherein the intervening fragment is greater than 100 base pairs. 
     
     
         39 . The method of  claim 37 , wherein the intervening fragment is greater than 100 base pairs. 
     
     
         40 . The method of  claim 36 , wherein the first and second single-molecule DNA-targeting RNAs are provided by introducing into the eukaryotic cell a nucleic acid encoding the first single-molecule DNA-targeting RNA and a nucleic acid encoding the second single-molecule DNA-targeting RNA, and wherein the Cas9 protein is provided by introducing into the eukaryotic cell a nucleic acid that comprises a nucleotide sequence encoding the Cas9 protein. 
     
     
         41 . The method of  claim 37 , wherein the first and second single-molecule DNA-targeting RNAs are provided by introducing into the eukaryotic cell a nucleic acid encoding the first single-molecule DNA-targeting RNA and a nucleic acid encoding the second single-molecule DNA-targeting RNA, and wherein the Cas9 protein is provided by introducing into the eukaryotic cell a nucleic acid that comprises a nucleotide sequence encoding the Cas9 protein. 
     
     
         42 . The method of  claim 36 , wherein the eukaryotic cell is a yeast cell, a plant cell, a non-human mammalian cell, or a human cell. 
     
     
         43 . The method of  claim 37 , wherein the eukaryotic cell is a yeast cell, a plant cell, a non-human mammalian cell, or a human cell. 
     
     
         44 . The method of  claim 40 , wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type Cas9 encoding nucleotide sequence with one or more different codons encoding the same amino acid. 
     
     
         45 . The method of  claim 41 , wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type Cas9 encoding nucleotide sequence with one or more different codons encoding the same amino acid. 
     
     
         46 . The method of  claim 36 , wherein the Cas9 protein is fused to one or more protein transduction domains (PTDs), wherein said one or more PTDs aids in traversal of the Cas9 protein from cytosol to within an organelle. 
     
     
         47 . The method of  claim 37 , wherein the Cas9 protein is fused to one or more protein transduction domains (PTDs), wherein said one or more PTDs aids in traversal of the Cas9 protein from cytosol to within an organelle. 
     
     
         48 . The method of  claim 46 , wherein at least one of said one or more PTDs comprises the amino acid sequence YGRKKRRQRRR (SEQ ID NO: 264), RRQRRTSKLMKR (SEQ ID NO: 265), RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         49 . The method of  claim 47 , wherein at least one of said one or more PTDs comprises the amino acid sequence YGRKKRRQRRR (SEQ ID NO: 264), RRQRRTSKLMKR (SEQ ID NO: 265), RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         50 . The method of  claim 36 , wherein the eukaryotic cell is an induced pluripotent stem cell. 
     
     
         51 . The method of  claim 37 , wherein the eukaryotic cell is an induced pluripotent stem cell. 
     
     
         52 . A composition, the composition comprising:
 (a) a Cas9 protein or a nucleic acid comprising a nucleotide sequence encoding the Cas9 protein; and   (b) a single-molecule DNA-targeting RNA or a nucleic acid comprising a nucleotide sequence encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
 a DNA-targeting segment comprising a 20 nucleotide long targeting sequence that is complementary to a target sequence in a target DNA within a eukaryotic cell; and 
 a protein-binding segment that is about 80 or about 100 nucleotides long, is capable of interacting with the Cas9 protein, and comprises two complementary stretches of nucleotides that are covalently linked by intervening nucleotides, wherein said complementary stretches of nucleotides hybridize to one another to form a stem-loop structure, 
   wherein the single-molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to said target sequence.   
     
     
         53 . A composition comprising:
 (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and   (b) a single-molecule DNA-targeting RNA or a nucleic acid encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA comprises a 103 nucleotide (nt) sequence that comprises, in 5′ to 3′ order:
 a 20 nucleotide (nt) targeting sequence that is complementary to a target sequence in a target DNA within a eukaryotic cell; 
 a 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 a 4 nt linker sequence GAAA, and 
 a 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUUUUUUU (SEQ ID NO: 432), 
   wherein the single-molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to said target sequence.   
     
     
         54 . The composition of  claim 52 , wherein the protein-binding segment comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441). 
     
     
         55 . An ex vivo eukaryotic cell containing the composition of  claim 52 . 
     
     
         56 . An ex vivo eukaryotic cell containing the composition of  claim 53 . 
     
     
         57 . The eukaryotic cell of  claim 55 , wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell, or a human cell. 
     
     
         58 . The eukaryotic cell of  claim 56 , wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell, or a human cell. 
     
     
         59 . The eukaryotic cell of  claim 55 , wherein the eukaryotic cell is a human induced pluripotent stem cell. 
     
     
         60 . The eukaryotic cell of  claim 56 , wherein the eukaryotic cell is a human induced pluripotent stem cell. 
     
     
         61 . The composition of  claim 52 , wherein the nucleotide sequence encoding the single-molecule DNA-targeting RNA is operably linked to a regulatory element that is operable in the eukaryotic cell. 
     
     
         62 . The composition of  claim 53 , wherein the nucleotide sequence encoding the single-molecule DNA-targeting RNA is operably linked to a regulatory element that is operable in the eukaryotic cell. 
     
     
         63 . The composition of  claim 52 , wherein the nucleotide sequence encoding the single-molecule DNA-targeting RNA is operably linked to a human U6 polymerase III promoter. 
     
     
         64 . The composition of  claim 53 , wherein the nucleotide sequence encoding the single-molecule DNA-targeting RNA is operably linked to a human U6 polymerase III promoter. 
     
     
         65 . The composition of  claim 52 , wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type Cas9 encoding nucleotide sequence with one or more different codons encoding the same amino acid. 
     
     
         66 . The composition of  claim 53 , wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type Cas9 encoding nucleotide sequence with one or more different codons encoding the same amino acid. 
     
     
         67 . The composition of  claim 65 , wherein the Cas9 protein is fused at its carboxyl terminus (C-terminus) to one or more protein transduction domains (PTDs), wherein said one or more PTDs aids in traversal of the Cas9 protein from cytosol to within an organelle. 
     
     
         68 . The composition of  claim 66 , wherein the Cas9 protein is fused at its carboxyl terminus (C-terminus) to one or more protein transduction domains (PTDs), wherein said one or more PTDs aids in traversal of the Cas9 protein from cytosol to within an organelle. 
     
     
         69 . The composition of  claim 67 , wherein at least one of said one or more PTDs comprises the amino acid sequence YGRKKRRQRRR (SEQ ID NO: 264), RRQRRTSKLMKR (SEQ ID NO: 265), RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         70 . The composition of  claim 68 , wherein at least one of said one or more PTDs comprises the amino acid sequence YGRKKRRQRRR (SEQ ID NO: 264), RRQRRTSKLMKR (SEQ ID NO: 265), RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         71 . The composition of  claim 65 , wherein the Cas9 protein is fused with three C-terminal SV40 nuclear localization sequences. 
     
     
         72 . The composition of  claim 66 , wherein the Cas9 protein is fused with three C-terminal SV40 nuclear localization sequences. 
     
     
         73 . The composition of  claim 65 , wherein the nucleotide sequence encoding the Cas9 protein is operably linked to a regulatory element that is operable in the eukaryotic cell. 
     
     
         74 . The composition of  claim 66 , wherein the nucleotide sequence encoding the Cas9 protein is operably linked to a regulatory element that is operable in the eukaryotic cell. 
     
     
         75 . The composition of  claim 52 , wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell, or a human cell. 
     
     
         76 . The composition of  claim 53 , wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell, or a human cell. 
     
     
         77 . The composition of  claim 52 , wherein the eukaryotic cell is a human induced pluripotent stem cell. 
     
     
         78 . The composition of  claim 53 , wherein the eukaryotic cell is a human induced pluripotent stem cell. 
     
     
         79 . The composition of  claim 52 , wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell, or a human cell. 
     
     
         80 . The composition of  claim 53 , wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell, or a human cell. 
     
     
         81 . The composition of  claim 52 , wherein the eukaryotic cell is a human induced pluripotent stem cell. 
     
     
         82 . The composition of  claim 53 , wherein the eukaryotic cell is a human induced pluripotent stem cell. 
     
     
         83 . An ex vivo eukaryotic cell comprising:
 (a) a Cas9 protein or a nucleic acid comprising a nucleotide sequence encoding the Cas9 protein; and   (b) a single-molecule DNA-targeting RNA or a nucleic acid comprising a nucleotide sequence encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
 a DNA-targeting segment comprising a 20 nucleotide long targeting sequence that is complementary to and capable of hybridizing with a target sequence in a target DNA within the eukaryotic cell; and 
 a protein-binding segment that is about 80 or about 100 nucleotides long, is capable of interacting with the Cas9 protein, and comprises two complementary stretches of nucleotides that are covalently linked by intervening nucleotides, wherein said complementary stretches of nucleotides hybridize to one another to form a stem-loop structure, 
   wherein the single-molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to said target sequence, and wherein the eukaryotic cell is a stem cell.   
     
     
         84 . An ex vivo eukaryotic cell comprising:
 (a) a Cas9 protein or a nucleic acid comprising a nucleotide sequence encoding the Cas9 protein; and   (b) a single-molecule DNA-targeting RNA or a nucleic acid comprising a nucleotide sequence encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA comprises a 103 nucleotide (nt) sequence that comprises, in 5′ to 3′ order:
 a 20 nucleotide (nt) targeting sequence that is complementary to and capable of hybridizing with a target sequence in a target DNA within the eukaryotic cell; 
 a 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 a 4 nt linker sequence GAAA, and 
 a 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUUUUUU (SEQ ID NO: 432), 
   wherein the single-molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to said target sequence, and wherein the eukaryotic cell is a stem cell   
     
     
         85 . The ex vivo eukaryotic cell of  claim 83 , wherein the stem cell is a human induced pluripotent stem cell. 
     
     
         86 . The ex vivo eukaryotic cell of  claim 84 , wherein the stem cell is a human induced pluripotent stem cell. 
     
     
         87 . A single-molecule DNA-targeting RNA comprising, in 5′ to 3′ order:
 a targeting sequence that is complementary to a target DNA sequence within a eukaryotic cell; 
 GUUUUAGAGCUA (SEQ ID NO: 679), which is a crRNA sequence; 
 GAAA, which is a linker sequence; and 
 UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUUUUUU (SEQ ID NO: 432), which is a 67 nt tracrRNA sequence.