US2023183825A1PendingUtilityA1
Gamma herpesvirus circular rna
Assignee: UNIV PITTSBURGH COMMONWEALTH SYS HIGHER EDUCATIONPriority: Jun 1, 2018Filed: Oct 25, 2022Published: Jun 15, 2023
Est. expiryJun 1, 2038(~11.8 yrs left)· nominal 20-yr term from priority
C12N 2310/321C12N 2310/11C12N 2310/315C12N 2310/341C12Q 1/705C12N 15/67C12N 15/1133C12N 2710/16222A61K 48/00C12N 15/63C12N 15/09
66
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
In an embodiment, the invention provides a method and reagents for detection of γ-herpesvirus circRNA. In another embodiment, the invention provides a method and reagents for detection of EBV circRNA. In still another embodiment, the invention provides a method and reagents for detection of KSHV circRNA. The method can be expanded to other herpesviruses and even non-herpesviruses that generate circRNA upon cellular infection.
Claims
exact text as granted — not AI-modified1 . An oligonucleotide that hybridizes, under high stringency conditions, to a sequence selected from the sequences set forth in the Examples set forth herein entitled “EXAMPLE 1—Epstein-Barr Virus (EBV) circRNA” and “EXAMPLE 2—Kaposi's Sarcoma-Associated Herpesvirus (KSHV) circRNA,” wherein said oligonucleotide comprises between 10 and 30 nucleic acids.
2 . An oligonucleotide that hybridizes to the BART small junction (SJ) sequence (TCGACGGGCAAGGTCCGGCGTGTC (SEQ ID NO:7)), the BART large junction (LJ) sequence (TCGACGGGCAAGATGCCATTGGGC (SEQ ID NO:8)), or the RF junction sequence (CATCTACCTCAGCCCCCGCGCCCC (SEQ ID NO:13).
3 . The oligonucleotide of claim 2 , which comprises the following sequence: GGGGCGCGGGGGCTGAGGUAGAUG (SEQ ID NO:14), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 14 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 14 is connected by a phosphorothioate bond.
4 . The oligonucleotide of claim 2 , which comprises the following sequence: GACACGCCGGACCTTGCCCGUCGA (SEQ ID NO:9), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 9 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 9 is connected by a phosphorothioate bond.
5 . The oligonucleotide of claim 2 , which comprises the following sequence: GCCCAATGGCATCTTGCCCGUCGA (SEQ ID NO:11), wherein each of the nucleotides at positions 1-6 and 19-24 of SEQ ID NO: 11 contains 2′-O-methylated ribose and each contiguous nucleotide of SEQ ID NO: 11 is connected by a phosphorothioate bond.
6 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of claim 1 to the mammal in an amount effective to treat or prevent the condition in the mammal.
7 . The method according to claim 6 , wherein the γ-herpesvirus infection is a KSHV infection.
8 . The method according to claim 6 , wherein the condition is Kaposi's Sarcoma or lymphoma.
9 . The method according to claim 6 , wherein the γ-herpesvirus infection is an EBV infection.
10 . The method according to claim 6 , wherein the condition is infectious mononucleosis, lymphoma, or nasopharyngeal cancer.
11 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of claim 3 to the mammal in an amount effective to treat or prevent the condition in the mammal.
12 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of claim 4 to the mammal in an amount effective to treat or prevent the condition in the mammal.
13 . A method of treating a condition associated with γ-herpesvirus infection in a mammal, the method comprising administering to the mammal the oligonucleotide of claim 5 to the mammal in an amount effective to treat or prevent the condition in the mammal.
14 . The method according to claim 11 , wherein the γ-herpesvirus infection is a KSHV infection.
15 . The method according to claim 11 , wherein the condition is Kaposi's Sarcoma or lymphoma.
16 . A composition comprising the oligonucleotide of claim 2 and a pharmaceutically-acceptable carrier.
17 . A composition comprising the oligonucleotide of claim 3 and a pharmaceutically-acceptable carrier.
18 . A composition comprising the oligonucleotide of claim 4 and a pharmaceutically-acceptable carrier.
19 . A composition comprising the oligonucleotide of claim 1 and a pharmaceutically-acceptable carrier.
20 . A vector comprising a circRNA and a gene of interest expressed under the control of a heterologous promoter.Join the waitlist — get patent alerts
Track US2023183825A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.