US2023151362A1PendingUtilityA1
Methods and means for efficient dkipping of exon 45 in duchenne muscular dystrophy pre-mrna
Est. expiryOct 26, 2027(~1.2 yrs left)· nominal 20-yr term from priority
Inventors:Josephus Johannes De KimpeAdriana Marie RusGerard Johannes PlatenburgJudith Christina Theodora Van DeutekomGarrit-Jan Boudewijn Van Ommen
C12N 2310/314A61K 31/57A61K 31/58C12N 2320/33C12N 2310/11C12N 2310/315C12N 2310/321C12N 15/113A61K 31/7088A61K 2300/00A61K 31/573A61K 48/0058C12N 2310/3233A61K 45/06A61P 39/06C12N 2310/313C12N 2310/3181A61P 29/00A61K 38/1719A61K 48/00A61K 31/56A61P 21/02C12N 2320/31A61P 25/28A61P 43/00A61P 21/04A61K 31/522A61P 21/00C12N 2310/31A61P 3/14C12N 2310/346C12N 2310/111C12N 2310/3231
84
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing said cell with an antisense molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such antisense molecule used in said method.
Claims
exact text as granted — not AI-modified1 . A molecule that binds to a continuous stretch of at least 21 nucleotides within exon 45 of DMD pre-mRNA, wherein the molecule comprises or consists of a 2′-O-alkyl phosphorothioate antisense oligonucleotide sequence selected from SEQ ID NOS: 9-67.
2 . The molecule according to claim 1 , whereby said molecule binds to a continuous stretch of at least 25 nucleotides within said exon.
3 . The molecule according to claim 1 , whereby said molecule comprises an antisense oligonucleotide of between 21 and 30 bases.
4 . The molecule according to claim 1 , whereby said molecule comprises an antisense oligonucleotide of 25 bases.
5 . The molecule according to claim 1 , whereby said molecule binds to a continuous stretch of at least 21 nucleotides within the following nucleotide sequence:
5′ - CCAGGAUGGCAUUGGGCAGCGGCAAACUGUUGUCAGA ACAUUGAAUGCAACUGGGGAAGAAAUAAUUCAGCAAUC - 3′ (SEQ ID NO: 2).
6 . The molecule according to claim 1 , comprising a 2′-O-methyl phosphorothioate ribose.
7 . A viral-based vector, comprising an expression cassette that drives expression of the molecule as defined in claim 1 .
8 . A pharmaceutical composition comprising the molecule as defined in claim 1 , a pharmaceutically acceptable carrier, and optionally a molecule having a base sequence selected from the base sequence of SEQ ID NOS:69-236 which is able to induce or promote skipping of exon 7, 44, 46, 51, 53, 59, or 67 of the DMD pre-mRNA of a patient.
9 . A method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a patient, the method comprising providing said patient with the molecule of claim 1 .
10 . The method according to claim 9 , wherein the patient is provided with a functional dystrophin protein and/or wherein the production of an aberrant dystrophin protein in said patient is decreased, wherein the level of said functional dystrophin is assessed by comparison to the level of said dystrophin in said patient at the onset of the method.Join the waitlist — get patent alerts
Track US2023151362A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.