US2023033866A1PendingUtilityA1
Compositions and methods for the targeting of rhodopsin
Est. expiryDec 6, 2039(~13.3 yrs left)· nominal 20-yr term from priority
Inventors:Benjamin OakesHannah SpinnerSarah DennyBrett T. StaahlKian TaylorKatherine BaneyIsabel ColinMaroof AdilCole UrnesSean Higgins
C12N 2750/14023C12N 15/86C12N 2750/14043C07K 14/705C12N 2800/80C07K 2319/09A61K 48/0066C12N 2750/14071C07K 2319/50C12N 9/22A61K 48/005C12N 2310/20A61K 38/00A61P 27/02C12N 15/11C12N 15/1138
60
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
Provided herein are Class 2 Type V CRISPR:gNA systems comprising Class 2 Type V CRISPR polypeptides (e.g. CasX), guide nucleic acids (gNA), and optionally donor template nucleic acids useful in the modification of a RHO gene. The systems are also useful for introduction into cells, for example eukaryotic cells having mutations in the rhodopsin protein. Also provided are methods of using such systems to modify cells having such mutations and utility in methods of treatment of a subject with a RHO-related disease, such as retinitis pigmentosa.
Claims
exact text as granted — not AI-modifiedWhat is claimed is:
1 . A composition comprising a Class 2 Type V CRISPR protein and a first guide nucleic acid (gNA), wherein the gNA comprises a targeting sequence complementary to a rhodopsin (RHO) gene target nucleic acid sequence, wherein the RHO gene comprises one or more mutations.
2 . The composition of claim 1 , wherein the RHO gene comprises one or more mutations in a region selected from the group consisting of:
a. a RHO intron; b. a RHO exon; c. a RHO intron-exon junction; d. a RHO regulatory element; and e. an intergenic region.
3 . The composition of any one of claim 1 or claim 2 , wherein the mutation is an insertion, deletion, substitution, duplication, or inversion of one or more nucleotides as compared to the wild-type RHO gene sequence.
4 . The composition of any one of claims 1 - 3 , wherein the mutation is a gain of function mutation.
5 . The composition of any one of claims 1 - 3 , wherein the RHO gene comprises a mutation set forth in Table 4A.
6 . The composition of any one of claims 1 - 5 , wherein the RHO gene comprising a mutation encodes a protein comprising a P23 or P23H substitution compared to a wild-type rhodopsin protein sequence of SEQ ID NO:100.
7 . The composition of any one of claims 1 - 6 , wherein the RHO gene encodes a non-functional rhodopsin protein.
8 . The composition of any one of claims 1 - 6 , wherein the gNA is a guide RNA (gRNA).
9 . The composition of any one of claims 1 - 6 , wherein the gNA is a guide DNA (gDNA).
10 . The composition of any one of claims 1 - 6 , wherein the gNA is a chimera comprising DNA and RNA.
11 . The composition of any one of claims 1 - 10 , wherein the gNA is a single-molecule gNA (sgNA).
12 . The composition of any one of claims 1 - 10 , wherein the gNA is a dual-molecule gNA (dgNA).
13 . The composition of any one of claims 1 - 12 , wherein the targeting sequence of the gNA comprises a sequence selected from the group consisting of the sequences of SEQ ID NOS:328-346, 367-376, 382-2100 and 2286-27274, or a sequence having at least about 65%, at least about 75%, at least about 85%, or at least about 95% identity thereto.
14 . The composition of any one of claims 1 - 12 , wherein the targeting sequence of the gNA comprises a sequence selected from the group consisting of the sequences of SEQ ID NOs:328-346, 367-376, 382-2100 and 2286-27274.
15 . The composition of any one of claims 1 - 12 , wherein the targeting sequence of the gNA comprises a sequence of SEQ ID NOs: 328-346, 367-376, 382-2100 and 2286-27274 with a single nucleotide removed from the 3′ end of the sequence.
16 . The composition of any one of claims 1 - 12 , wherein the targeting sequence of the gNA comprises a sequence of SEQ ID NOs: 2328-346, 367-376, 382-2100 and 2286-27274 with two nucleotides removed from the 3′ end of the sequence.
17 . The composition of any one of claims 1 - 12 , wherein the targeting sequence of the gNA comprises a sequence of SEQ ID NOs: 328-346, 367-376, 382-2100 and 2286-27274 with three nucleotides removed from the 3′ end of the sequence.
18 . The composition of any one of claims 1 - 12 , wherein the targeting sequence of the gNA comprises a sequence of SEQ ID NOs: 328-346, 367-376, 382-2100 and 2286-27274 with four nucleotides removed from the 3′ end of the sequence.
19 . The composition of any one of claims 1 - 12 , wherein the targeting sequence of the gNA comprises a sequence of SEQ ID NOs: 328-346, 367-376, 382-2100 and 2286-27274 with five nucleotides removed from the 3′ end of the sequence.
20 . The composition of any one of claims 1 - 19 , wherein the targeting sequence of the gNA comprises a sequence having one or more single nucleotide polymorphisms (SNP) relative to a sequence of SEQ ID NOS: 328-346, 367-376, 382-2100 and 2286-27274.
21 . The composition of any one of claims 1 - 19 , wherein the targeting sequence of the gNA is complementary to a sequence of a RHO exon.
22 . The composition of any one of claims 1 - 21 , wherein the targeting sequence of the gNA is complementary to a sequence of RHO exon 1.
23 . The composition of claim 21 or claim 22 , wherein the targeting sequence of the gNA is complementary to a target nucleic acid sequence encoding the P23H substitution.
24 . The CasX:gNA system of any one of claims 21 - 23 , wherein the targeting sequence of the gNA comprises a sequence of AAGUGGCUGCGUACCACACC (SEQ ID NO: 382).
25 . The CasX:gNA system of any one of claims 21 - 23 , wherein the targeting sequence of the gNA consists of a sequence of AAGUGGCUGCGUACCACACC (SEQ ID NO: 382).
26 . The CasX:gNA system of any one of claims 21 - 23 , wherein the targeting sequence of the gNA consists of a sequence of AAGUGGCUGCGUACCACAC (SEQ ID NO: 27275).
27 . The CasX:gNA system of any one of claims 21 - 23 , wherein the targeting sequence of the gNA consists of a sequence of AAGUGGCUGCGUACCACA (SEQ ID NO: 27276).
28 . The CasX:gNA system of any one of claims 21 - 23 , wherein the targeting sequence of the gNA consists of a sequence of AAGUGGCUGCGUACCAC (SEQ ID NO: 27277).
29 . The CasX:gNA system of any one of claims 21 - 23 , wherein the targeting sequence of the gNA consists of a sequence of AAGUGGCUGCGUACCA (SEQ ID NO: 27278).
30 . The CasX:gNA system of any one of claims 21 - 23 , wherein the targeting sequence of the gNA consists of a sequence of AAGUGGCUGCGUACC (SEQ ID NO: 27279).
31 . The composition of any one of claims 1 - 19 , wherein the targeting sequence of the gNA is complementary to a sequence of a RHO intron.
32 . The composition of any one of claims 1 - 19 , wherein the targeting sequence of the gNA is complementary to a sequence of a RHO intron-exon junction.
33 . The composition of any one of claims 1 - 19 , wherein the targeting sequence of the gNA is complementary to a sequence of a RHO regulatory element.
34 . The composition of any one of claims 1 - 19 , wherein the targeting sequence of the gNA is complementary to a sequence comprising one or more single nucleotide polymorphisms (SNPs) of the RHO gene.
35 . The composition of any one of claims 1 - 19 , wherein the targeting sequence of the gNA is complementary to a sequence of an intergenic region of the RHO gene.
36 . The composition of any one of claims 1 - 35 , further comprising a second gNA, wherein the second gNA has a targeting sequence complementary to a different or overlapping portion of the RHO target nucleic acid compared to the targeting sequence of the first gNA.
37 . The composition of claim 36 , wherein the second gNA has a targeting sequence complementary to the same exon targeted by the first gNA.
38 . The composition of claim 36 , wherein the second gNA has a targeting sequence complementary to a different exon targeted by the first gNA.
39 . The composition of claim 36 , wherein the second gNA has a targeting sequence complementary to an intron 3′ to the exon targeted by the first gNA.
40 . The composition of any one of claims 1 - 39 , wherein the first or second gNA has a scaffold comprising a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 2201-2285.
41 . The composition of any one of claims 1 - 39 , wherein the first or second gNA has a scaffold comprising a sequence selected from the group consisting of SEQ ID NOS: 2201-2285.
42 . The composition of any one of claims 1 - 39 , wherein the first or second gNA scaffold comprises a sequence having at least one modification relative to a reference gNA sequence selected from the group consisting of SEQ ID NOS: 4-16.
43 . The composition of claim 42 , wherein the at least one modification of the reference gNA comprises at least one substitution, deletion, or substitution of a nucleotide of the reference gNA sequence.
44 . The composition of any one of claims 1 - 43 , wherein the first or second gNA is chemically modified.
45 . The composition of any one of claims 1 - 44 , wherein the Class 2 Type V CRISPR protein is a reference CasX protein having a sequence of any one of SEQ ID NOS: 1-3, a CasX variant protein having a sequence of SEQ ID NOs: 49-160, 237-239, 243-246, 251-263 or 273-281, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% sequence identity thereto.
46 . The composition of any one of claims 1 - 44 , wherein the Class 2 Type V CRISPR protein is a CasX variant protein having a sequence of SEQ ID NOs: 49-160, 237-239, 243-246, 251-263 or 273-281
47 . The composition of claim 45 , wherein the CasX variant protein comprises at least one modification relative to a reference CasX protein having a sequence selected from SEQ ID NOS:1-3.
48 . The composition of claim 47 , wherein the at least one modification comprises at least one amino acid substitution, deletion, or substitution in a domain of the CasX variant protein relative to the reference CasX protein.
49 . The composition of claim 48 , wherein the domain is selected from the group consisting of a non-target strand binding (NTSB) domain, a target strand loading (TSL) domain, a helical I domain, a helical II domain, an oligonucleotide binding domain (OBD), and a RuvC DNA cleavage domain.
50 . The composition of any one of claims 45 - 49 , wherein the CasX protein further comprises one or more nuclear localization signals (NLS).
51 . The composition of claim 50 , wherein the one or more NLS are selected from the group of sequences consisting of SEQ ID NOS: 176-213.
52 . The composition of claim 50 or claim 51 , wherein the one or more NLS are expressed at or near the C-terminus of the CasX protein.
53 . The composition of claim 50 or claim 51 , wherein the one or more NLS are expressed at or near the N-terminus of the CasX protein.
54 . The composition of claim 50 or claim 51 , comprising one or more NLS located at or near the N-terminus and at or near the C-terminus of the CasX protein.
55 . The composition of any one of claims 45 - 54 , wherein the Class 2 Type V CRISPR protein is capable of forming a ribonuclear protein complex (RNP) with the gNA.
56 . The composition of claim 55 , wherein an RNP comprising the CasX variant protein and the gNA exhibit at least one or more improved characteristics as compared to an RNP comprising the reference CasX protein of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 and a gNA comprising a sequence of any one of SEQ ID NOS: 4-16.
57 . The composition of claim 56 , wherein the improved characteristic is selected from one or more of the group consisting of improved folding of the CasX variant; improved binding affinity to a guide nucleic acid (gNA); improved binding affinity to a target DNA; improved ability to utilize a greater spectrum of one or more PAM sequences, including ATC, CTC, GTC, or TTC, in the editing of target DNA; improved unwinding of the target DNA; increased editing activity; improved editing efficiency; improved editing specificity; increased nuclease activity; increased target strand loading for double strand cleavage; decreased target strand loading for single strand nicking; decreased off-target cleavage; improved binding of non-target DNA strand; improved protein stability; improved protein solubility; improved protein:gNA complex (RNP) stability; improved protein:gNA complex solubility; improved protein yield; improved protein expression; and improved fusion characteristics.
58 . The composition of claim 56 or claim 57 , wherein the improved characteristic of the RNP of the CasX variant protein and the gNA variant is at least about 1.1 to about 100-fold or more improved relative to the RNP of the reference CasX protein of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 and the gNA comprising a sequence of any one of SEQ ID NOS: 4-16.
59 . The composition of claim 56 or claim 57 , wherein the improved characteristic of the CasX variant protein is at least about 1.1, at least about 2, at least about 10, at least about 100-fold or more improved relative to the reference CasX protein of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 and the gNA comprising a sequence of any one of SEQ ID NOS: 4-16.
60 . The composition of any one of claims 56 - 59 , wherein the improved characteristic comprises editing efficiency, and the RNP of the CasX variant protein and the gNA variant comprises a 1.1 to 100-fold improvement in editing efficiency compared to the RNP of the reference CasX protein of SEQ ID NO: 2 and the gNA of any one of SEQ ID NOS: 4-16.
61 . The composition of any one of claims 56 - 60 , wherein the RNP comprising the CasX variant and the gNA variant exhibits greater editing efficiency and/or binding of a target sequence in the target nucleic acid when any one of the PAM sequences TTC, ATC, GTC, or CTC is located 1 nucleotide 5′ to the non-target strand sequence having identity with the targeting sequence of the gNA in a cellular assay system compared to the editing efficiency and/or binding of an RNP comprising a reference CasX protein and a reference gNA in a comparable assay system.
62 . The composition of claim 61 , wherein the PAM sequence is TTC.
63 . The composition of claim 62 , wherein the targeting sequence of the gNA comprises a sequence selected from the group consisting of SEQ ID NOs: 370-371, 373-376, and 19918-27274.
64 . The composition of claim 61 , wherein the PAM sequence is ATC
65 . The composition of claim 64 , wherein the targeting sequence of the gNA comprises a sequence selected from the group consisting of SEQ ID NOs: 583-2100, and 2286-5554.
66 . The composition of claim 61 , wherein the PAM sequence is CTC.
67 . The composition of claim 66 , wherein the targeting sequence of the gNA comprises a sequence selected from the group consisting of SEQ ID NOs: 367-369, 372, and 10487-19917.
68 . The composition of claim 61 , wherein the PAM sequence is GTC.
69 . The composition of claim 68 , wherein the targeting sequence of the gNA comprises a sequence selected from the group consisting of SEQ ID NOs: 5555-10486.
70 . The composition of any one of claims 61 - 69 , wherein the increased binding affinity for the one or more PAM sequences is at least 1.5-fold greater compared to the binding affinity of any one of the reference CasX proteins of SEQ ID NOS: 1-3 for the PAM sequences.
71 . The composition of any one of claims 56 - 70 , wherein the RNP has at least a 5%, at least a 10%, at least a 15%, or at least a 20% higher percentage of cleavage-competent RNP compared to an RNP of the reference CasX proteins of SEQ ID NOS: 1-3 and the gNA of SEQ ID NOS: 4-16.
72 . The composition of any one of claims 45 - 71 , wherein the CasX variant protein comprises a RuvC DNA cleavage domain having nickase activity.
73 . The composition of any one of claims 45 - 71 , wherein the CasX variant protein comprises a RuvC DNA cleavage domain having double-stranded cleavage activity.
74 . The composition of any one of claims 45 - 71 , wherein the CasX protein is a catalytically inactive CasX (dCasX) protein, and wherein the dCasX and the gNA retain the ability to bind to the RHO target nucleic acid.
75 . The composition of claim 74 , wherein the dCasX comprises a mutation at residues:
a. D672, E769, and/or D935 corresponding to the CasX protein of SEQ ID NO:1; or b. D659, E756 and/or D922 corresponding to the CasX protein of SEQ ID NO: 2.
76 . The composition of claim 75 , wherein the mutation is a substitution of alanine for the residue.
77 . The composition of any one of claims 1 - 73 , further comprising a donor template nucleic acid.
78 . The composition of claim 77 , wherein the donor template comprises a nucleic acid comprising at least a portion of a RHO gene selected from the group consisting of a RHO exon, a RHO intron, a RHO intron-exon junction, and a RHO regulatory element.
79 . The composition of claim 78 , wherein the donor template comprises a wild-type nucleic acid sequence.
80 . The composition of claim 78 , wherein the donor template comprises a nucleic acid sequence having one or more mutations relative to the wild-type RHO gene sequence.
81 . The composition of any one of claims 77 - 80 , wherein the donor template ranges in size from 10-10,000 nucleotides.
82 . The composition of any one of claims 77 - 81 , wherein the donor template is a single-stranded DNA template or a single stranded RNA template.
83 . The composition of any one of claims 77 - 81 , wherein the donor template is a double-stranded DNA template.
84 . The composition of any one of claims 77 - 83 , wherein the donor template comprises homologous arms at or near the 5′ and 3′ ends of the donor template that are complementary to sequences flanking cleavage sites in the RHO target nucleic acid introduced by the Class 2 Type V CRISPR protein.
85 . A nucleic acid comprising the donor template of any one of claims 77 - 84 .
86 . A nucleic acid comprising a sequence that encodes the CasX of any one of claims 45 - 76 .
87 . A nucleic acid comprising a sequence that encodes the gNA of any one of claims 1 - 44 .
88 . The nucleic acid of claim 86 , wherein the sequence that encodes the CasX protein is codon optimized for expression in a eukaryotic cell.
89 . A vector comprising the gNA of any one of claims 1 - 44 , the CasX protein of any one of claims 45 - 76 , or the nucleic acid of any one of claims 85 - 88 .
90 . The vector of claim 89 , wherein the vector further comprises a promoter.
91 . The vector of claim 89 or claim 90 , wherein the vector is selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes simplex virus (HSV) vector, a virus-like particle (VLP), a plasmid, a minicircle, a nanoplasmid, a DNA vector, and an RNA vector.
92 . The vector of claim 91 , wherein the vector is an AAV vector.
93 . The vector of claim 92 , wherein the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV 44.9, AAV-Rh74, or AAVRh10.
94 . The vector of claim 93 , wherein the AAV vector is selected from AAV1, AAV2, AAV5, AAV8, or AAV9.
95 . The vector of claim 91 , wherein the vector is a retroviral vector.
96 . The vector of claim 91 , wherein the vector is a VLP vector comprising one or more components of a gag polyprotein.
97 . The vector of claim 96 , wherein the one or more components of the gag polyprotein are selected from the group consisting of matrix protein (MA), nucleocapsid protein (NC), capsid protein (CA), p1-p6 protein, and protease cleavage site.
98 . The vector of claim 96 or claim 97 , comprising the CasX protein and the gNA.
99 . The vector of claim 98 , wherein the CasX protein and the gNA are associated together in an RNP.
100 . The vector of any one of claims 96 - 99 , further comprising the donor template.
101 . The vector of any one of claims 96 - 100 , further comprising a pseudotyping viral envelope glycoprotein or antibody fragment that provides for binding and fusion of the VLP to a target cell.
102 . A host cell comprising the vector of any one of claims 89 - 101 .
103 . The host cell of claim 101 , wherein the host cell is selected from the group consisting of BHK, HEK293, HEK293T, NS0, SP2/0, YO myeloma cells, P3X63 mouse myeloma cells, PER, PER.C6, NIH3T3, COS, HeLa, CHO, and yeast cells.
104 . A method of modifying a RHO target nucleic acid sequence in a population of cells, wherein the RHO target nucleic acid comprises one or more mutations, the method comprising introducing into cells of the population:
a. the composition of any one of claims 1 - 84 ; b. the nucleic acid of any one of claims 85 - 88 ; c. the vector of any one of claims 89 - 101 ; or d. combinations of two or more of (a)-(c),
wherein the RHO target nucleic acid sequence of the cells targeted by the first gNA is modified by the CasX protein.
105 . The method of claim 104 , wherein the modifying comprises introducing a single-stranded break in the RHO target nucleic acid sequence of the cells of the population.
106 . The method of claim 104 , wherein the modifying comprises introducing a double-stranded break in the RHO target nucleic acid sequence of the cells of the population.
107 . The method of any one of claims 104 - 106 , further comprising introducing into the cells of the population a second gNA or a nucleic acid encoding the second gNA, wherein the second gNA has a targeting sequence complementary to a different or overlapping portion of the RHO target nucleic acid compared to the first gNA, resulting in an additional break in the RHO target nucleic acid of the cells of the population.
108 . The method of any one of claims 104 - 107 , wherein the modifying comprises introducing an insertion, deletion, substitution, duplication, or inversion of one or more nucleotides in the RHO target nucleic acid of the cells of the population.
109 . The method of any one of claims 104 - 108 , wherein the RHO target nucleic acid of at least 10% of the cells of the population is modified.
110 . The method of claim 108 , wherein the modifying results in a knocking down or knocking out of the RHO gene in the cells of the population such that expression of non-functional rhodopsin protein is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% in comparison to a cell where the RHO gene has not been modified.
111 . The method of claim 108 , wherein the RHO gene of the cells of the population is modified such that at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the modified cells do not express a detectable level of non-functional rhodopsin protein.
112 . The method of claim 108 , wherein the modifying results in a correction or compensation of the mutation of the RHO gene in the cells of the population such that functional rhodopsin protein is expressed by the cells.
113 . The method of claim 108 , wherein expression of the functional rhodopsin protein by the cells of the population is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% in comparison to a cell where the RHO gene has not been modified.
114 . The method of any one of claims 104 - 107 , wherein the method comprises insertion of the donor template into the break site(s) of the RHO gene target nucleic acid sequence of the cells of the population.
115 . The method of claim 114 , wherein the insertion of the donor template is mediated by homology-directed repair (HDR) or homology-independent targeted integration (HITI).
116 . The method of claim 114 or claim 115 , wherein insertion of the donor template results in a correction or compensation of the RHO gene in the cells of the population such that functional rhodopsin protein is expressed by the cells.
117 . The method of claim 114 , wherein expression of the functional rhodopsin protein by the cells of the population is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% in comparison to a cell where the RHO gene has not been modified.
118 . The method of any one of claims 114 - 116 , wherein the RHO gene of the cells of the population is modified such that at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the modified cells express a detectable level of functional rhodopsin.
119 . The method of claim 114 or claim 115 , wherein insertion of the donor template results in a knocking down or knocking out the RHO gene in the cells of the population such that expression of a non-functional rhodopsin protein is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% in comparison to a cell where the RHO gene has not been modified of the RHO gene in the cells of the population.
120 . The method of claim 114 or claim 115 , wherein the RHO gene of the cells of the population is modified such that at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the modified cells do not express a detectable level of non-functional rhodopsin protein.
121 . The method of any one of claims 104 - 120 , wherein the cells are eukaryotic.
122 . The method of claim 121 , wherein the eukaryotic cells are selected from the group consisting of rodent cells, mouse cells, rat cells, and non-human primate cells.
123 . The method of claim 121 , wherein the eukaryotic cells are human cells.
124 . The method of claim 121 - 123 , wherein the eukaryotic cells are selected from the group consisting of a neuron, a rod photoreceptor cell, a retinal progenitor cell, a pluripotent stem cell (iPSC), a fibroblast, and a Müller glial cell.
125 . The method of any one of claim 104 - 124 , wherein the modifying of the RHO gene target nucleic acid sequence of the population of cells occurs in vitro or ex vivo.
126 . The method of claims 104 - 125 , wherein the modifying of the RHO gene target nucleic acid sequence of the population of cells occurs in vivo in a subject.
127 . The method of claim 126 , wherein the subject is selected from the group consisting of a rodent, a mouse, a rat, and a non-human primate.
128 . The method of claim 126 , wherein the subject is a human.
129 . The method of any one of claims 126 - 128 , wherein the method comprises administering a therapeutically effective dose of an AAV vector to the subject.
130 . The method of claim 129 , wherein the AAV vector is administered to the subject at a dose of at least about 1×10 5 vector genomes (vg), at least about 1×10 5 vector genomes (vg)/kg, at least about 1×10 6 vg/kg, at least about 1×10 7 vg/kg, at least about 1×10 8 vg/kg, at least about 1×10 9 vg/kg, at least about 1×10 10 vg/kg, at least about 1×10 11 vg/kg, at least about 1×10 12 vg/kg, at least about 1×10 13 vg/kg, at least about 1×10 14 vg/kg, at least about 1×10 15 vg/kg, or at least about 1×10 16 vg/kg.
131 . The method of claim 129 , wherein the AAV vector is administered to the subject at a dose of at least about 1×10 5 vg/kg to about 1×10 16 vg/kg, at least about 1×10 6 vg/kg to about 1×10 15 vg/kg, at least about 1×10 7 vg/kg to about 1×10 14 vg/kg, at least about 1×10 8 vg/kg to about 1×10 13 vg/kg, at least about 1×10 9 vg/kg to about 1×10 12 vg/kg, or at least about 1×10 10 vg/kg to about 1×10 11 vg/kg.
132 . The method of any one of claims 126 - 128 , wherein the method comprises administering a therapeutically effective dose of a VLP to the subject.
133 . The method of claim 132 , wherein the VLP is administered to the subject at a dose of at least about 1×10 5 particles/kg, at least about 1×10 6 particles/kg, at least about 1×10 7 particles/kg, at least about 1×10 8 particles/kg, at least about 1×10 9 particles/kg, at least about 1×10 10 particles/kg, at least about 1×10 11 particles/kg, at least about 1×10 12 particles/kg, at least about 1×10 13 particles/kg, at least about 1×10 14 particles/kg, at least about 1×10 15 particles/kg, at least about 1×101 6 particles/kg.
134 . The method of claim 132 , wherein the VLP is administered to the subject at a dose of at least about 1×10 5 particles/kg to about 1×10 16 particles/kg, at least about 1×10 6 particles/kg to about 1×10 15 particles/kg, at least about 1×10 7 particles/kg to about 1×10 14 particles/kg, at least about 1×10 8 particles/kg to about 1×10 13 particles/kg, at least about 1×10 9 particles/kg to about 1×10 12 particles/kg, at least about 1×10 10 particles/kg to about 1×10 11 particles/kg.
135 . The method of any one of claims 127 - 134 wherein the vector or VLP is administered to one or both eyes of the subject by a route of administration selected from intraocular, intravitreal, subretinal, or suprachoroidal injection or implantation.
136 . The method of any one of claims 104 - 134 , further comprising contacting the RHO target nucleic acid sequence of the population of cells with:
a. an additional CRISPR nuclease and a gNA targeting a different or overlapping portion of the RHO target nucleic acid compared to the first gNA; b. a polynucleotide encoding the additional CRISPR nuclease and the gNA of (a); c. a vector comprising the polynucleotide of (b); or d. a VLP comprising the additional CRISPR nuclease and the gNA of (a);
wherein the contacting results in modification of the RHO gene at a different location in the sequence compared to the sequence targeted by the first gNA.
137 . The method of claim 136 , wherein the additional CRISPR nuclease is a CasX protein having a sequence different from the CasX protein of any of the preceding claims.
138 . The method of claim 136 , wherein the additional CRISPR nuclease is not a CasX protein.
139 . The method of claim 138 , wherein the additional CRISPR nuclease is selected from the group consisting of Cas9, Cas12a, Cas12b, Cas12c, Cas12d (CasY), Cas12J, Cas13a, Cas13b, Cas13c, Cas13d, CasX, CasY, Cas14, Cpf1, C2c1, Csn2, Cas Phi, and sequence variants thereof.
140 . A population of cells modified by the method of any one of claims 104 - 139 , wherein the cells have been modified such that at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the modified cells do not express a detectable level of non-functional rhodopsin protein.
141 . A population of cells modified by the method of any one of claims 104 - 139 , wherein the mutation of the RHO target nucleic acid is corrected or compensated for in the modified cells of the population, resulting in expression of a functional rhodopsin protein by the modified cells.
142 . The population of cells of claim 141 , wherein the cells have been modified such that expression of a functional rhodopsin protein is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% in comparison to a cell where the RHO gene has not been modified.
143 . The population of cells of any one of claim 140 - 142 , wherein the cells are selected from the group consisting of a neuron, a rod photoreceptor cell, a retinal progenitor cell, a pluripotent stem cell (iPSC), a fibroblast, and a Müller glial cell.
144 . A method of treating a RHO-related disease in a subject in need thereof, the method comprising administering to one or both eyes of the subject a therapeutically effective amount of the cells of any one of claims 140 - 143 .
145 . The method of claim 144 , wherein the RHO-related disease is retinitis pigmentosa.
146 . The method of claim 144 or claim 145 , wherein the subject is selected from the group consisting of a rodent, a mouse, a rat, and a non-human primate.
147 . The method of any one of claims 144 - 146 , wherein the subject is a human.
148 . The method of any one of claims 144 - 147 , wherein the cells are autologous with respect to the subject to be administered the cells.
149 . The method of any one of claims 144 - 147 wherein the cells are allogeneic with respect to the subject to be administered the cells.
150 . The method of any one of claims 144 - 149 , wherein the cells are administered by a route of administration selected from intraocular, intravitreal, subretinal, or suprachoroidal injection or implantation.
151 . A method of treating a RHO-related disease in a subject in need thereof, comprising modifying a RHO gene having one or more mutations in eye cells of the subject, the modifying comprising contacting said cells in one or both eyes with a therapeutically effective dose of:
a. the composition of any one of claims 1 - 84 ; b. the nucleic acid of any one of claims 85 - 88 ; c. the vector as in any one of claims 89 - 95 ; d. the VLP of any one of claims 96 - 101 ; or e. combinations of two or more of (a)-(d),
wherein the RHO gene of the cells targeted by the first gNA is modified by the CasX protein.
152 . The method of claim 151 , wherein the modifying comprises introducing a single-stranded break in the RHO gene of the cells.
153 . The method of claim 151 , wherein the modifying comprises introducing a double-stranded break in the RHO gene of the cells.
154 . The method of any one of claims 151 - 153 , further comprising introducing into the cells of the subject a second gNA or a nucleic acid encoding the second gNA, wherein the second gNA has a targeting sequence complementary to a different or overlapping portion of the target nucleic acid compared to the first gNA, resulting in an additional break in the RHO target nucleic acid of the cells of the subject.
155 . The method of any one of claims 151 - 153 , wherein the modifying comprises introducing an insertion, deletion, substitution, duplication, or inversion of one or more nucleotides in the RHO gene of the cells.
156 . The method of any one of claims 151 - 154 , wherein the modifying comprises insertion of the donor template into the break site(s) of the RHO gene target nucleic acid sequence of the cells.
157 . The method of claim 156 , wherein the insertion of the donor template is mediated by homology-directed repair (HDR) or homology-independent targeted integration (HITI).
158 . The method of any one of claims 151 - 157 , wherein the modifying results in a correction of or compensation for the mutation(s) in the RHO gene in the modified cells of the subject.
159 . The method of claim 158 , wherein correction of the mutation results in expression of functional rhodopsin protein by the modified cells of the subject.
160 . The method of claim 158 or claim 159 , wherein the RHO gene of the modified cells express increased levels of a functional rhodopsin protein, wherein the increase is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% in comparison to a cell with a RHO gene that has not been modified.
161 . The method of any one of claims 151 - 157 , wherein the modifying results in a knocking down or knocking out the RHO gene in the modified cells of the subject such that at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% of the modified cells do not express a detectable level of non-functional rhodopsin protein.
162 . The method of any one of claims 151 - 157 , wherein the modifying results in a knocking down or knocking out the RHO gene in the modified cells of the subject such that expression of non-functional rhodopsin protein in the subject is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% in comparison to a subject where the RHO gene has not been modified.
163 . The method of any one of claims 151 - 162 , wherein the subject is selected from the group consisting of rodent, mouse, rat, and non-human primate.
164 . The method of any one of claims 151 - 162 , wherein the subject is a human.
165 . The method of any one of claims 151 - 162 , wherein the cells that are modified are selected from the group consisting of a neuron, a rod photoreceptor cell, a retinal progenitor cell, a pluripotent stem cell (iPSC), a fibroblast, and a Müller glial cell.
166 . The method of any one of claims 151 - 164 , wherein the RHO-related disease is retinitis pigmentosa.
167 . The method of any one of claims 151 - 165 , wherein the vector is administered to the subject at a therapeutically-effective dose.
168 . The method of any one of claims 151 - 167 , wherein the vector is an AAV, and is administered to the subject at a dose of at least about 1×10 5 vector genomes (vg)/kg, at least about 1×10 6 vg/kg, at least about 1×10 7 vg/kg, at least about 1×10 8 vg/kg, at least about 1×10 9 vg/kg, at least about 1×10 10 vg/kg, at least about 1×10 11 vg/kg, at least about 1×10 12 vg/kg, at least about 1×10 13 vg/kg, at least about 1×10 14 vg/kg, at least about 1×10 15 vg/kg, or at least about 1×10 16 vg/kg.
169 . The method of any one of claims 151 - 167 , wherein the vector is an AAV, and is administered to the subject at a dose of at least about 1×10 5 vg/kg to about 1×10 16 vg/kg, at least about 1×10 6 vg/kg to about 1×10 15 vg/kg, at least about 1×10 7 vg/kg to about 1×10 14 vg/kg, at least about 1×10 8 vg/kg to about 1×10 13 vg/kg, at least about 1×10 9 vg/kg to about 1×10 12 vg/kg, or at least about 1×10 10 vg/kg to about 1×10 11 vg/kg.
170 . The method of any one of claims 151 - 165 , wherein the VLP is administered to the subject at a therapeutically-effective dose.
171 . The method of claim 169 , wherein the VLP is administered to the subject at a dose of at least about 1×10 5 particles/kg, at least about 1×10 6 particles/kg, at least about 1×10 7 particles/kg, at least about 1×10 8 particles/kg, at least about 1×10 9 particles/kg, at least about 1×10 10 particles/kg, at least about 1×10 11 particles/kg, at least about 1×10 12 particles/kg, at least about 1×10 13 particles/kg, at least about 1×10 14 particles/kg, at least about 1×10 15 particles/kg, at least about 1×101 6 particles/kg.
172 . The method of claim 170 , wherein the VLP is administered to the subject at a dose of at least about 1×10 5 particles/kg to about 1×10 16 particles/kg, at least about 1×10 6 particles/kg to about 1×10 15 particles/kg, at least about 1×10 7 particles/kg to about 1×10 14 particles/kg, at least about 1×10 8 particles/kg to about 1×10 13 particles/kg, at least about 1×10 9 particles/kg to about 1×10 12 particles/kg, at least about 1×10 10 particles/kg to about 1×10 11 particles/kg.
173 . The method of any one of claims 167 - 171 , wherein the vector or VLP is administered to one or both eyes of the subject by a route of administration selected from intraocular, intravitreal, subretinal, or suprachoroidal injection or implantation.
174 . The method of any one of claims 151 - 172 , wherein the method results in improvement in at least one clinically-relevant endpoint selected from the group consisting of mean change or mean rate of change in: 1) best corrected visual acuity (BCVA); 2) visual field sensitivity (including analysis of hill of vision volumes); 3) retinal sensitivity measured by full-field stimulus testing (FST); 4) multiluminance mobility tests; 5) electrophysiological measures of retinal function; 6) optical coherence tomography (OCT) documenting the rate of photoreceptor loss; and 7) hypo- or hyperfluorescent lesion size on fundus autofluorescence; 8) color vision; 9) contrast sensitivity; 10) gaze tracking; 11) light aversion; 12) macular sensitivity.
175 . The method of any one of claims 151 - 172 , wherein the method results in improvement in at least two clinically-relevant endpoints selected from the group consisting of mean change or mean rate of change in: 1) best corrected visual acuity (BCVA); 2) visual field sensitivity (including analysis of hill of vision volumes); 3) retinal sensitivity measured by full-field stimulus testing (FST); 4) multiluminance mobility tests; 5) electrophysiological measures of retinal function; 6) optical coherence tomography (OCT) documenting the rate of photoreceptor loss; and 7) hypo- or hyperfluorescent lesion size on fundus autofluorescence; 8) color vision; 9) contrast sensitivity; 10) gaze tracking; 11) light aversion; 12) macular sensitivity.
176 . The composition of claim 1 , wherein the target nucleic acid sequence is complementary to a non-target strand sequence located 1 nucleotide 3′ of a protospacer adjacent motif (PAM) sequence.
177 . The composition of claim 176 , wherein the PAM sequence comprises a TC motif.
178 . The composition of claim 177 , wherein the PAM sequence comprises ATC, GTC, CTC or TTC.
179 . The composition of any one of claims 176 - 178 , wherein the Class 2 Type V CRISPR protein comprises a RuvC domain.
180 . The composition of claim 179 , wherein the RuvC domain generates a staggered double-stranded break in the target nucleic acid sequence.
181 . The composition of any one of claims 176 - 180 , wherein the Class 2 Type V CRISPR protein does not comprise an HNH nuclease domain.
182 . A composition of any one of claims 1 - 84 or claims 176 - 181 ; a nucleic acid of any one of claims 85 - 88 ; a vector of any one of claims 89 - 95 ; a VLP of any one of claims 96 - 101 ; or combinations thereof, for use as a medicament for the treatment of a RHO-related disease.Join the waitlist — get patent alerts
Track US2023033866A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.