Nucleic acid products and methods of administration thereof

Abstract

The present invention relates in part to nucleic acids, including nucleic acids encoding proteins, therapeutics and cosmetics comprising nucleic acids, methods for delivering nucleic acids to cells, tissues, organs, and patients, methods for inducing cells to express proteins using nucleic acids, methods, kits and devices for transfecting, gene editing, and reprogramming cells, and cells, organisms, therapeutics, and cosmetics produced using these methods, kits, and devices.

1 - 179 . (canceled) 
     
     
         180 . A composition comprising a cell obtained from a subject having a Z mutation in an alpha-1 antitrypsin (A1AT) gene, the cell comprising:
 (a) a synthetic RNA encoding a gene-editing protein capable of creating a single-strand or double-strand break in an A1AT gene, the gene-editing protein comprising:
 (i) a DNA-binding domain comprising a plurality of repeat sequences, wherein at least one of the repeat sequences comprises the amino acid sequence: LTPvQVVAIAwxyzGHGG (SEQ ID NO: 629) and is between 36 and 39 amino acids long, wherein:
 “v” is Q, D or E, 
 “w” is S or N, 
 “x” is H, N, or I, 
 “y” is D, A, I, N, G, H, K, S, or null, and 
 “z” is GGKQALETVQRLLPVLCQD (SEQ ID NO: 630) or GGKQALETVQRLLPVLCQA (SEQ ID NO: 631); and 
 
 (ii) a nuclease domain comprising a catalytic domain of a nuclease, 
 wherein the gene-editing protein targets a sequence selected from TGCCTGGTCCCTGTCTCCCT (SEQ ID NO: 615) and TGTCTTCTGGGCAGCATCTC (SEQ ID NO: 616) and located approximately 75 bp from the A1AT start codon; 
 wherein the gene-editing protein does not target the sequence comprising the Z mutation; and 
   (b) a single-strand or double-strand break in the A1AT gene, the single-strand or double-strand break being caused by the gene-editing protein.   
     
     
         181 . The composition of  claim 180 , wherein the synthetic RNA comprises one or more non-canonical nucleotides that avoid substantial cellular toxicity. 
     
     
         182 . The composition of  claim 180 , wherein the composition is suitable for administration to the liver. 
     
     
         183 . The composition of  claim 180 , wherein the composition is suitable for intraportal injection. 
     
     
         184 . The composition of  claim 180 , wherein the nuclease domain is capable of forming a dimer with another nuclease domain. 
     
     
         185 . The composition of  claim 180 , wherein the gene-editing protein, either alone or in combination with one or more other molecules, confers correction of the Z mutation. 
     
     
         186 . The composition of  claim 180 , wherein the gene-editing protein, either alone or in combination with one or more other molecules, confers reduction of polymerized Z protein accumulation. 
     
     
         187 . The composition of  claim 180 , wherein the gene-editing protein, either alone or in combination with one or more other molecules, confers an increase in secretion and/or serum levels of functional A1AT. 
     
     
         188 . A composition comprising a cell obtained from a subject having a Z mutation in an alpha-1 antitrypsin (A1AT) gene, the cell comprising:
 (a) a synthetic RNA encoding a gene-editing protein capable of creating a single-strand or double-strand break in A1AT_A (SEQ ID NO: 584) and/or a synthetic RNA encoding a gene-editing protein capable of creating a single-strand or double-strand break in A1AT_B (SEQ ID NO: 585), wherein the gene-editing protein comprises:
 (i) a DNA-binding domain comprising a plurality of repeat sequences, wherein at least one of the repeat sequences comprises the amino acid sequence: LTPvQVVAIAwxyzGHGG (SEQ ID NO: 629) and is between 36 and 39 amino acids long, wherein:
 “v” is Q, D or E, 
 “w” is S or N, 
 “x” is H, N, or I, 
 “y” is D, A, I, N, G, H, K, S, or null, and 
 “z” is GGKQALETVQRLLPVLCQD (SEQ ID NO: 630) or GGKQALETVQRLLPVLCQA (SEQ ID NO: 631); and 
 
 (ii) a nuclease domain comprising a catalytic domain of a nuclease, 
 wherein the gene-editing protein targets a sequence selected from TGCCTGGTCCCTGTCTCCCT (SEQ ID NO: 615) and TGTCTTCTGGGCAGCATCTC (SEQ ID NO: 616) and located approximately 75 bp from the A1AT start codon; 
 wherein the gene-editing protein does not target the sequence comprising the Z mutation; and 
   (b) a single-strand or double-strand break in an the A1AT gene, the single-strand or double-strand break being caused by the gene-editing protein.   
     
     
         189 . The composition of  claim 188 , comprising:
 (a) the synthetic RNA encoding the gene-editing protein capable of creating a single-strand or double-strand break in A1AT_A (SEQ ID NO: 584), and   (b) the synthetic RNA encoding the gene-editing protein capable of creating a single-strand or double-strand break in A1AT_B (SEQ ID NO: 585).   
     
     
         190 . The composition of  claim 188 , wherein the synthetic RNA comprises one or more non-canonical nucleotides that avoid substantial cellular toxicity. 
     
     
         191 . The composition of  claim 188 , wherein the composition is suitable for administration to the liver. 
     
     
         192 . The composition of  claim 188 , wherein the composition is suitable for intraportal injection. 
     
     
         193 . The composition of  claim 188 , wherein the nuclease domain is capable of forming a dimer with another nuclease domain. 
     
     
         194 . The composition of  claim 188 , wherein the gene-editing protein, either alone or in combination with one or more other molecules, confers correction of the Z mutation. 
     
     
         195 . The composition of  claim 188 , wherein the gene-editing protein, either alone or in combination with one or more other molecules, confers reduction of polymerized Z protein accumulation. 
     
     
         196 . The composition of  claim 188 , wherein the gene-editing protein, either alone or in combination with one or more other molecules, confers an increase in secretion and/or serum levels of functional A1AT.