Modulation of Angiopoietin-Like 3 Expression

Abstract

Provided herein are methods, compounds, and compositions for reducing expression of an ANGPTL3 mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for reducing lipids and/or glucose in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of cardiovascular disease and/or metabolic disease, or a symptom thereof, in an individual in need thereof.

1 . 21 . (canceled) 
     
     
         22 . A method of treating, preventing, or slowing progression of a cardiovascular or metabolic disease, comprising administering to subject a pharmaceutical composition comprising a compound, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or diluent, said compound comprising a modified oligonucleotide and a conjugate group, and said modified oligonucleotide having the following formula:
 GGACATTGCCAGTAATCGCA, wherein
 A is an adenine nucleobase, 
 C is a 5′-methylcytosine nucleobase, 
 G is a guanine nucleobase, 
 T is a thymine nucleobase, 
 each of nucleosides 1 to 5, and 16 to 20, comprises a modified sugar, 
 each of nucleosides 6 to 15 is a deoxyribonucleoside, and 
 at least one internucleoside linkage is a phosphorothioate internucleoside linkage, wherein said administering of said pharmaceutical composition to said subject treats, prevents, or slows the progression of said cardiovascular or metabolic disease. 
   
     
     
         23 . The method of  claim 22 , wherein said subject is a human. 
     
     
         24 . The method of  claim 23 , wherein said cardiovascular or metabolic disease is selected from the group consisting of hypercholesterolemia, dyslipidemia, hypertriglyceridemia, coronary artery disease (CAD), familial chylomicronemia syndrome (FCS), hyperlipoproteinemia, lipodystrophy, hyperlipidemia, metabolic syndrome, non-alcoholic fatty liver disease (NAFLD), nonalcoholic steatohepatitis (NASH), diabetes, vascular wall thickening, high blood pressure, sclerosis, obesity, and hyperfattyacidemia. 
     
     
         25 . The method of  claim 24 , wherein said conjugate group is linked to the 5′-end of said modified oligonucleotide. 
     
     
         26 . The method of  claim 24 , wherein said conjugate group is selected from the group consisting of a carbohydrate, a cholesterol moiety, a lipid moiety. 
     
     
         27 . The method of  claim 25 , wherein each internucleoside linkage of nucleosides 6 to 15 is a phosphorothioate internucleoside linkage. 
     
     
         28 . The method of  claim 25 , wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. 
     
     
         29 . The method of  claim 27 , wherein said modified sugar is selected from the group consisting of a 5′-methyl furanose, a 5′-vinyl furanose, a 2′-fluoro-5′-methyl furanose, a 2′-fluoro furanose, a 2′-OCH 3  furanose, a 2′-OCH 2 CH 3  furanose, a 2′-OCH 2 CH 2 F furanose, a 2′-O-allyl furanose, a 2′-OCH 2 CH 2 CH 3  furanose, a 2′-OCH 2 CH 2 OCH 3  furanose, a 2′-OCH 2 CH 2 CH 2 CH 3  furanose, a 2′-OCF 3  furanose, a 2′-OCH 2 F furanose, a 2′-OCH 2 CH 2 SCH 3  furanose, and a 2′-OCH 2 CH 2 ON(R m )(R n ) furanose, wherein R m  is H or (C 1 -C 10 )alkyl, and R n  is H or (C 1 -C 10 )alkyl. 
     
     
         30 . The method of  claim 29 , wherein said modified sugar is a 2′-OCH 2 CH 2 OCH 3  furanose. 
     
     
         31 . The method of  claim 30 , wherein said pharmaceutically acceptable salt is a sodium salt or a potassium salt. 
     
     
         32 . The method of  claim 30 , wherein said wherein said pharmaceutically acceptable carrier or diluent is phosphate-buffered saline (PBS). 
     
     
         33 . The method of  claim 31 , wherein said disease is dyslipidemia. 
     
     
         34 . The method of  claim 33 , wherein said dyslipidemia is a combination of hypertriglyceridemia and hypercholesterolemia. 
     
     
         35 . The method of  claim 31 , wherein said disease is NAFLD. 
     
     
         36 . The method of  claim 35 , wherein said disease is NAFLD is hepatic steatosis. 
     
     
         37 . The method of  claim 31 , wherein said disease is diabetes. 
     
     
         38 . The method of  claim 37 , wherein said diabetes is type 2 diabetes. 
     
     
         39 . The method of  claim 31 , wherein said administering comprises parenteral administration. 
     
     
         40 . The method of  claim 31 , further comprising administering a second agent. 
     
     
         41 . The method of  claim 40 , wherein said second agent is selected from the group consisting of a glucose-lowering agent and a lipid-lowering agent. 
     
     
         42 . The method of  claim 40 , wherein said second agent is co-administered with said pharmaceutical composition.