US2022396799A1PendingUtilityA1

Therapeutic inhibition of lactate dehydrogenase and agents therefor

Assignee: DICERNA PHARMACEUTICALS INCPriority: Oct 10, 2014Filed: May 13, 2022Published: Dec 15, 2022
Est. expiryOct 10, 2034(~8.2 yrs left)· nominal 20-yr term from priority
Y02A50/30C12N 2310/315C12N 2320/32C12N 15/113A61P 21/00C12Y 101/01027A61P 1/16C12N 2310/332C12N 2310/14C12N 2310/533A61P 35/00A61P 13/02C12N 15/1137A61K 31/713A61P 13/12A61P 43/00A61P 7/00
75
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

This invention relates to compounds, compositions, and methods useful for reducing lactate dehydrogenase target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents.

Claims

exact text as granted — not AI-modified
1 - 106 . (canceled) 
     
     
         107 . A method of treating a subject having excessive urinary excretion of oxalate, comprising administering to the subject a therapeutically effective amount of a lactic acid dehydrogenase A (LDHA) targeting Dicer substrate siRNA (DsiRNA) comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises at least 19 consecutive nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5′-UCAGAUAAAAAGGACAACAUGC-3′ (SEQ ID NO: 7193); and wherein the sense strand comprises a nucleotide sequence AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 7192), thereby reducing expression of the LDHA gene in one or more tissues of the subject. 
     
     
         108 . The method of  claim 107 , wherein the excessive urinary excretion of oxalate causes urolithiasis, nephrocalcinosis or kidney stones. 
     
     
         109 . The method of  claim 107 , wherein the subject is treated for urolithiasis, nephrocalcinosis or kidney stones. 
     
     
         110 . The method of  claim 107 , wherein the DsiRNA reduces accumulation of oxalate. 
     
     
         111 . The method of  claim 107 , wherein the subject is a human. 
     
     
         112 . The method of  claim 111 , wherein the DsiRNA is administered to the human at about 1.0 mg/kg, 3 mg/kg, 5 mg/kg, or 10 mg/kg. 
     
     
         113 . The method of  claim 107 , wherein the DsiRNA was administered through intravenous injection, intramuscular injection, intraperitoneal injection, infusion, subcutaneous injection, transdermal, aerosol, rectal, vaginal, topical, oral or inhaled delivery. 
     
     
         114 . The method of  claim 107 , wherein the DsiRNA is formulated in a lipid nanoparticle formulation. 
     
     
         115 . The method of  claim 107 , wherein the antisense strand comprises at least 19 consecutive nucleotides differing by 2 or fewer nucleotides from the nucleotide sequence 5′-UCAGAUAAAAAGGACAACAUGC-3′ (SEQ ID NO: 7193). 
     
     
         116 . The method of  claim 107 , wherein the antisense strand comprises at least 19 consecutive nucleotides differing by 1 or fewer nucleotides from the nucleotide sequence 5′-UCAGAUAAAAAGGACAACAUGC-3′ (SEQ ID NO: 7193). 
     
     
         117 . The method of  claim 107 , wherein the antisense strand comprises at least 19 consecutive nucleotides from the nucleotide sequence 5′-UCAGAUAAAAAGGACAACAUGC-3′ (SEQ ID NO: 7193). 
     
     
         118 . The method of  claim 107 , wherein the antisense strand comprises a modified nucleotide with methylphosphonate. 
     
     
         119 . The method of  claim 107 , wherein all the nucleotides of the sense and antisense strand double stranded region are modified nucleotides. 
     
     
         120 . The method of  claim 119 , wherein the modified nucleotides are selected from the group consisting of a 2′-O-methyl-modified nucleotides and 2′-fluoro-modified nucleotides. 
     
     
         121 . The method of  claim 107 , wherein the sense strand is attached to one or more N-acetylgalactosamine (GalNAc) moieties. 
     
     
         122 . The method of  claim 107 , wherein the sense and antisense strands comprise a phosphate backbone modification selected from the group consisting of a methylphosphonate, a phosphorothioate and a phosphotriester. 
     
     
         123 . The method of  claim 107 , wherein the sense strand and the antisense strand comprise a phosphorothioate linkage. 
     
     
         124 . The method of  claim 107 , wherein the antisense strand is 22 nucleotides in length. 
     
     
         125 . The method of  claim 107 , wherein the sense strand and the antisense strand are fully complementary in the double stranded region formed by the sense strand and the antisense strand. 
     
     
         126 . The method of  claim 107 , wherein the antisense strand comprises a 3′ overhang of 2 nucleotides.

Join the waitlist — get patent alerts

Track US2022396799A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.