US2022333194A1PendingUtilityA1

Rna sequencing method for the analysis of b and t cell transcriptome in phenotypically defined b and t cell subsets

Assignee: INSERM INSTPriority: Aug 8, 2019Filed: Aug 7, 2020Published: Oct 20, 2022
Est. expiryAug 8, 2039(~13 yrs left)· nominal 20-yr term from priority
C12Q 1/6881C12Q 1/6869C12N 15/1096C12N 15/1065C12Q 2525/121C12Q 2521/107C12Q 2563/179
26
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Single-cell RNA sequencing (scRNAseq) allows the identification, characterization, and quantification of cell types in a tissue. When focused on the adaptive immune system's T and B cells, scRNAseq carries the potential to track the clonal lineage of each analyzed cell through the unique rearranged sequence of its antigen receptor (TCR or BCR, respectively), and link it to the functional state inferred from transcriptome analysis. Computational approaches to infer clonality and maturation status (for BCR only) from scRNAseq datasets of T and B cells have been developed but there are cumbersome and not costly effective. The inventors have now developed a FACS-based 5′-end RNAseq method, in particular a FACS-based 5′-end scRNAseq method, for cost effective integrative analysis of B and T cell transcriptome and paired BCR and TCR repertoire in phenotypically defined B and T cell subsets. In particular, the method of the present invention includes a reverse transcription step that uses a number of different well specific template switching oligonucleotides (TSO) to introduce a well-specific DNA barcode in the 5′-end of cDNAs.

Claims

exact text as granted — not AI-modified
1 . A template switching oligonucleotide (TSO) comprising:
 a 5′-terminal PCR handle sequence,   a barcode sequence,   a Unique Molecular Identifier (UMI) sequence,   an insulator sequence, and   a 3′ terminal sequence consisting of 3 riboguanosine (rG).   
     
     
         2 . The TSO of  claim 1  wherein the 5′-terminal PCR handle sequence comprises the sequence 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 1) 
                 
                     
                   AGACGTGTGCTCTTCCGATCT 
                 
             
                
                
               
            
           
         
       
     
     
         3 . The TSO of  claim 1  wherein the barcode sequence is selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO:97 and SEQ ID NO:233 to SEQ:251. 
     
     
         4 . The TSO of  claim 1  which consists of comprises a sequence selected from the group consisting of SEQ ID NO:99 to SEQ ID NO:194. 
     
     
         5 . A method for preparing DNA that is complementary to an RNA molecule, the method comprising conducting a reverse transcription reaction with the RNA molecule in the presence of the template switching oligonucleotide (TSO) of  claim 1 . 
     
     
         6 . An RNA sequencing method comprising the steps of:
 a) providing a sample comprising RNA molecules,   b) conducting reverse transcription (RT) of said RNA molecules by performing the method of  claim 5 ,   c) amplification of the amplifying cDNAs obtained at step b),   d) pooling and purifying the cDNAs,   e) preparing a cDNA library from purified cDNAs obtained in step d), and   f) sequencing said cDNA library.   
     
     
         7 . A single-cell RNA sequencing method comprising the steps of:
 a) isolating single cells,   b) lysing the single cells and extracting RNA molecules,   c) conducting reverse transcription (RT) of said RNA molecules by performing the method of  claim 5 ,   d) amplifying cDNAs obtained at step c),   e) pooling and purifying the cDNAs,   f) preparing a cDNA library from purified cDNAs obtained in step e), and   g) sequencing said cDNA library.   
     
     
         8 . The method of  claim 6  wherein the step of conducting reverse transcription (RT) is performed using 96 different well-specific template switching oligonucleotides (TSO) to introduce a well-specific DNA barcode at the 5′-end of cDNAs, wherein said template switching oligonucleotides are sequences SEQ ID NOS: 99-194. 
     
     
         9 . The method of  claim 7  to wherein the single cells are B cells and/or T cells. 
     
     
         10 . The method of  claim 7  wherein the step of lysing is performed with a lysis mixture comprising an RNase inhibitor, an amount of dNTP and an amount of a primer suitable for priming the reverse transcription of polyadenylated mRNAs while incorporating a universal PCR handle at the 3′-end of cDNA molecules, wherein the primer comprises the sequence TGCGGTATCTAAAGCGGTGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO:195), wherein V represents dG, dA, or dC and N represents dA, dT, dG, or dC. 
     
     
         11 . The method of  claim 6  wherein the step of amplifying is performed by PCR-based amplification and uses a pair of primers comprising a forward primer having the sequence AGACGTGTGCTCTTCCGATCT (SEQ ID NO:196) and a reverse primer having the sequence TGCGGTATCTAAAGCGGTGAG (SEQ ID NO:197). 
     
     
         12 . The method of  claim 6  wherein the step of preparing a cDNA library comprises subjecting the purified cDNAs to a tagmentation reaction with a plurality of adapters sequences as set forth in SEQ ID NOS: 214-229. 
     
     
         13 . The method of  claim 6  wherein the step of sequencing of the cDNA library is performed with the primers SEQ ID NOS: 230-232. 
     
     
         14 . A method of performing an integrative analysis of a B and T cell transcriptome and paired T cell receptor (TCR)/B cell receptor (BCR) repertoire in phenotypically defined B and T cell subsets of a subject, comprising
 a) obtaining from the subject B and T cells that are phenotypically defined,   b) lysing the B and T cells,   c) extracting RNA molecules from a lysate obtained in step b),   d) conducting reverse transcription (RT) of the RNA molecules to obtain cDNAs by performing the method of  claim 5 ,   e) amplifying the cDNAs,   f) pooling and purifying the cDNAs to obtain purified cDNAs,   g) preparing a cDNA library from the purified cDNAs,   h) sequencing the cDNA library, and   i) performing the integrative analysis using sequence data obtained in the sequencing step.   
     
     
         15 . A method of, for B and T cell subsets: obtaining a dataset that includes sequence information, representation of V, D, J, C, VJ, VDJ, VJC, VDJC, antibody heavy chain, antibody light chain, CDR3, or T-cell receptor usage, representation for abundance of V, D, J, C, VJ, VDJ, VJC, VDJC, antibody heavy chain, antibody light chain, CDR3, or T-cell receptor and unique sequences; representation of mutation frequency, correlative measures of VJ V, D, J, C, VJ, VDJ, VJC, VDJC, antibody heavy chain, antibody light chain, CDR3, or T-cell receptor usage, comprising
 performing an integrative analysis of a B and T cell transcriptome and paired T cell receptor (TCR)/B cell receptor (BCR) repertoire for the B and T cell subsets by the method of  claim 14 .   
     
     
         16 . The method of  claim 15  wherein results obtained in said performing step are output or stored in a database of repertoire analyses, and used in comparisons with a reference or control repertoire to make a desired analysis. 
     
     
         17 . A method of, in a subject: diagnosing an immune response, monitoring an immune response after or during a therapy, assessing a vaccine response, assessing clonal rearrangements and/or chromosomal translocations that occur in lymphoma, assessing an immune response that could lead to transplant rejection assessing immunosenescence, or for diagnosing immunodeficiencies, the method comprising
 performing an integrative analysis of phenotypically defined B and T cells of the subject by the method of  claim 14 , wherein results obtained from the step of performing are used to diagnose the immune response, monitor the immune response, assess the vaccine response, assess the clonal rearrangements and/or chromosomal translocations, assess the immune response that could lead to transplant rejection, assess the immunosenescence or diagnose the immunodeficiencies in the subject.   
     
     
         18 . A method for selecting an antibody that specifically binds to an antigen of interest comprising (a) immunizing an animal with an antigen of interest; (b) isolating a plurality of B-cells from the immunized animal; (c) characterizing the plurality of B cells by carrying out the scRNAseq method of  claim 6  and (d) providing the sequences of the antibody of interest. 
     
     
         19 . A kit which comprises a plurality of TSO according to  claim 1 . 
     
     
         20 . The kit of  claim 19  which comprises the 96 TSO of SEQ ID NO:99 to SEQ ID NO:194. 
     
     
         21 . The kit of  claim 19  which further comprises one or more of a panel of antibodies for cell sorting, primers, dNTPs, adapter sequences and/or a post synthesis labelling reagent at least one buffer mediums, and purification beads. 
     
     
         22 . The kit of  claim 19  which further comprises a software package for statistical analysis, wherein the software package optionally includes a reference database for calculating the probability of a match between two repertoires.

Join the waitlist — get patent alerts

Track US2022333194A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.