Compositions and methods for detecting and treating insulin resistance

Abstract

A miR-1983 inhibitor comprising an anti-miR-1983 oligonucleotide that is complementary to at least part of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1), the part comprising at least nucleotides 2 to 8 of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1).

1 .- 19 . (canceled) 
     
     
         20 . A method of detecting if a cell is insulin resistant comprising measuring a level of miR-1983 and comparing to a threshold or control, wherein an increased level compared to the control is indicative the cell is insulin resistant. 
     
     
         21 . The method of  claim 20  wherein the cell is a neuronal cell. 
     
     
         22 . The method  claim 20  wherein the cell is a human cell. 
     
     
         23 . A method of detecting pre-diabetes or an increased likelihood of developing diabetes in a subject, the method comprising measuring a level of miR-1983 in a biological sample from the subject, wherein an increased level compared to a threshold or control is indicative that the subject has an increased likelihood of developing diabetes. 
     
     
         24 . The method of  claim 23  wherein detection occurs before the dysregulation of one or more neuropeptides in the hypothalamus. 
     
     
         25 . The method of  claim 24  wherein the one or more neuropeptides are NP or, AgRP. 
     
     
         26 . The method of  claim 23  wherein the sample is a serum sample. 
     
     
         27 . The method of  claim 23  wherein the level of miR-1983 is measured by a quantitative PCR method. 
     
     
         28 . The method of  claim 27  wherein the quantitative PCR method comprises generating cDNA from RNA obtained from the cell or biological sample, amplifying the cDNA using sequence specific primers and quantifying the level of miR1983. 
     
     
         29 . The method of  claim 23  wherein the subject is human. 
     
     
         30 . The method of  claim 29  wherein the human subject has a body mass index of less than 25. 
     
     
         31 . The method of  claim 29  wherein the human subject has a body mass index between 25 and 29. 
     
     
         32 . The method of  claim 29  wherein the human subject has a body mass index of more than 30. 
     
     
         33 .- 35 . (canceled) 
     
     
         36 . The method of  claim 21 , wherein the neuronal cell is a hypothalamic cell. 
     
     
         37 . The method of  claim 36 , wherein the hypothalamic cell is a Neuropeptide Y expressing hypothalamic cell. 
     
     
         38 . The method of  claim 20 , wherein the biological sample is one of blood, plasma or serum, urine or tissue and/or is taken from a subject that has fasted for at least 8 hours. 
     
     
         39 . The method of  claim 20 , wherein the control is a pre-determined standard. 
     
     
         40 . the method of  claim 20 , wherein the level miR-1983 is measuring one or more hybridization probes or microarray analysis. 
     
     
         41 . The method of  claim 20 , the measuring comprises
 polyadenylating the miRNA with ATP and a poly(A) polymerase to form a polyadenylated miRNA having a sequence of contiguous A residues; reverse transcribing the polyadenylated miRNA to form a cDNA in a reaction mixture comprising (i) a first primer of not more than 40 nucleotides in length having complementarity to at least two 3′ terminal nucleotides of the miRNA and the sequence of contiguous A residues of the polyadenylated miRNA so as to hybridize therewith and initiate synthesis of a cDNA complementary to the polyadenylated miRNA, (ii) a reverse transcriptase and (iii) all four deoxyribonucleoside triphosphates;   amplifying a DNA molecule comprising the cDNA in a reaction mixture comprising (i) the cDNA, (ii) the first primer; (iii) a second primer that is sufficiently complementary to the 3′ nucleotides of the cDNA to hybridize therewith and initiate synthesis of an extension product; (iv) a DNA polymerase and (v) all four deoxyribonucleoside triphosphates; and   (d) detecting and/or quantifying the amplified DNA molecule, wherein the presence and/or quantity of the amplified DNA corresponds to that of the miRNA.