Oligonucleotide compounds for targeting huntingtin mrna

Abstract

This disclosure relates to novel huntingtin targets. Novel oligonucleotides for the treatment of Huntington's disease are also provided.

1 - 76 . (canceled) 
     
     
         77 . A recombinant adeno-associated virus (rAAV) vector comprising a stem-loop structure comprising a nucleotide sequence encoding an RNA duplex comprising a sense strand and an antisense strand; wherein the antisense strand is between 16 and 22 nucleotides in length and comprises a region of complementarity; and wherein the region of complementarity in the antisense strand is complementary to at least 16 contiguous nucleotides of 5′ GCCUGCUAGCUCCAUGCUUA 3′ (SEQ ID NO: 17). 
     
     
         78 . The rAAV vector of  claim 77 , wherein the region of complementarity in the antisense strand is complementary to at least 17 contiguous nucleotides of SEQ ID NO: 17. 
     
     
         79 . The rAAV vector of  claim 77 , wherein the region of complementarity in the antisense strand is complementary to at least 18 contiguous nucleotides of SEQ ID NO: 17. 
     
     
         80 . The rAAV vector of  claim 77 , wherein the sense strand is between 16 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 80% identical to SEQ ID NO: 17. 
     
     
         81 . The rAAV vector of  claim 77 , wherein the sense strand is between 17 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 17. 
     
     
         82 . The rAAV vector of  claim 77 , wherein the sense strand is between 18 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 90% identical to SEQ ID NO: 17. 
     
     
         83 . The rAAV vector of  claim 77 , wherein the antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328). 
     
     
         84 . The rAAV vector of  claim 77 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328). 
     
     
         85 . The rAAV vector of  claim 77 , wherein the antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328); and wherein the sense strand is between 17 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 17. 
     
     
         86 . The rAAV vector of  claim 77 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328); and wherein the sense strand is between 18 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 90% identical to SEQ ID NO: 17. 
     
     
         87 . The rAAV vector of  claim 77 , wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand, are each 21 nucleotides in length. 
     
     
         88 . The rAAV vector of  claim 77 , wherein the sense strand and the antisense strand comprise at least one mismatched base pair. 
     
     
         89 . A recombinant adeno-associated virus (rAAV) comprising the rAAV vector of  claim 77  and an AAV capsid. 
     
     
         90 . A pharmaceutical composition comprising the rAAV of  claim 89  and a pharmaceutically acceptable carrier. 
     
     
         91 . A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the rAAV vector of  claim 77 . 
     
     
         92 . A method of treating Huntington's Disease in a subject, the method comprising administering to the subject a therapeutically effective amount of the rAAV of  claim 89 . 
     
     
         93 . The method of  claim 92 , wherein the rAAV is administered intravenously. 
     
     
         94 . The method of  claim 92 , wherein administering the rAAV to the subject causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the subject. 
     
     
         95 . The method of  claim 91 , wherein the cell is: (i) a CNS cell; (ii) a neuronal cell or an astrocyte; or (iii) in a subject. 
     
     
         96 . The method of  claim 95 , wherein the subject has Huntington's Disease.