US2022251554A1PendingUtilityA1
Oligonucleotide compounds for targeting huntingtin mrna
Est. expiryApr 3, 2035(~8.7 yrs left)· nominal 20-yr term from priority
C12N 2310/3517C12N 2310/346C12N 2310/3515C12N 2320/30C12N 2310/344C12N 15/113C12N 2310/321C12N 2310/315C12N 2310/343C12N 2320/51C12N 2320/11C12N 2310/322A61K 9/0085C12N 2310/3519A61K 31/713C12N 2310/14C12N 2320/32C12N 2310/52A61P 25/14A61P 43/00
78
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
This disclosure relates to novel huntingtin targets. Novel oligonucleotides for the treatment of Huntington's disease are also provided.
Claims
exact text as granted — not AI-modified1 - 76 . (canceled)
77 . A recombinant adeno-associated virus (rAAV) vector comprising a stem-loop structure comprising a nucleotide sequence encoding an RNA duplex comprising a sense strand and an antisense strand; wherein the antisense strand is between 16 and 22 nucleotides in length and comprises a region of complementarity; and wherein the region of complementarity in the antisense strand is complementary to at least 16 contiguous nucleotides of 5′ GCCUGCUAGCUCCAUGCUUA 3′ (SEQ ID NO: 17).
78 . The rAAV vector of claim 77 , wherein the region of complementarity in the antisense strand is complementary to at least 17 contiguous nucleotides of SEQ ID NO: 17.
79 . The rAAV vector of claim 77 , wherein the region of complementarity in the antisense strand is complementary to at least 18 contiguous nucleotides of SEQ ID NO: 17.
80 . The rAAV vector of claim 77 , wherein the sense strand is between 16 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 80% identical to SEQ ID NO: 17.
81 . The rAAV vector of claim 77 , wherein the sense strand is between 17 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 17.
82 . The rAAV vector of claim 77 , wherein the sense strand is between 18 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 90% identical to SEQ ID NO: 17.
83 . The rAAV vector of claim 77 , wherein the antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328).
84 . The rAAV vector of claim 77 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328).
85 . The rAAV vector of claim 77 , wherein the antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328); and wherein the sense strand is between 17 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 17.
86 . The rAAV vector of claim 77 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328); and wherein the sense strand is between 18 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 90% identical to SEQ ID NO: 17.
87 . The rAAV vector of claim 77 , wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand, are each 21 nucleotides in length.
88 . The rAAV vector of claim 77 , wherein the sense strand and the antisense strand comprise at least one mismatched base pair.
89 . A recombinant adeno-associated virus (rAAV) comprising the rAAV vector of claim 77 and an AAV capsid.
90 . A pharmaceutical composition comprising the rAAV of claim 89 and a pharmaceutically acceptable carrier.
91 . A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the rAAV vector of claim 77 .
92 . A method of treating Huntington's Disease in a subject, the method comprising administering to the subject a therapeutically effective amount of the rAAV of claim 89 .
93 . The method of claim 92 , wherein the rAAV is administered intravenously.
94 . The method of claim 92 , wherein administering the rAAV to the subject causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the subject.
95 . The method of claim 91 , wherein the cell is: (i) a CNS cell; (ii) a neuronal cell or an astrocyte; or (iii) in a subject.
96 . The method of claim 95 , wherein the subject has Huntington's Disease.Join the waitlist — get patent alerts
Track US2022251554A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.