US2022243228A1PendingUtilityA1

Methods and products for expressing proteins in cells

Assignee: FACTOR BIOSCIENCE INCPriority: Nov 1, 2012Filed: Apr 12, 2022Published: Aug 4, 2022
Est. expiryNov 1, 2032(~6.3 yrs left)· nominal 20-yr term from priority
A61K 38/465C12Y 301/21004A61K 31/7115C12N 15/907A61P 11/02A61P 35/02A61P 27/02C07K 2319/80A61P 31/00A61P 17/00A61K 35/14C12N 15/1024A61P 13/02A61P 13/08A61P 21/00A61P 37/06A61P 5/00A61P 19/00A61K 2035/124A61P 11/04G01N 33/5014A61P 1/18C12N 15/113C12Y 301/00A61P 25/14A61P 13/12C12N 9/22A61P 25/16A61P 5/14A61P 25/00C12N 15/86C07K 14/195A61P 1/04A61K 48/005A61P 1/16C12N 15/85A61P 21/04A61P 15/00A61P 1/02A61P 25/28A61P 9/00A61P 11/00C12N 2800/80A61P 13/10A61P 35/00
84
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present invention relates in part to nucleic acids encoding proteins, therapeutics comprising nucleic acids encoding proteins, methods for inducing cells to express proteins using nucleic acids, methods, kits and devices for transfecting, gene editing, and reprogramming cells, and cells, organisms, and therapeutics produced using these methods, kits, and devices. Methods and products for altering the DNA sequence of a cell are described, as are methods and products for inducing cells to express proteins using synthetic RNA molecules. Therapeutics comprising nucleic acids encoding gene-editing proteins are also described.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
         1 . A synthetic RNA molecule comprising at least two of: 5-methyluridine, 5-methylcytidine, and 7-deazaguanosine. 
     
     
         2 . The synthetic RNA molecule of  claim 1 , further comprising at least one residue of each of 5-methyluridine, 5-methylcytidine, and 7-deazaguanosine. 
     
     
         3 . The synthetic RNA molecule of  claim 1 , wherein the synthetic RNA molecule comprises uridine moieties and between about 20% and about 80% of the uridine moieties are 5-methyluridines. 
     
     
         4 . The synthetic RNA molecule of  claim 1 , wherein the synthetic RNA molecule comprises cytidine moieties and between about 50% and about 100% of the cytidine moieties are 5-methylcytidines. 
     
     
         5 . The synthetic RNA molecule of  claim 1 , wherein the synthetic RNA molecule comprises guanosine moieties and between about 20% and about 80% of the guanosine moieties are 7-deazaguanosines. 
     
     
         6 . The synthetic RNA molecule of  claim 2 , wherein the synthetic RNA molecule comprises uridine, cytidine, and guanosine moieties and between about 20% and about 80% of the uridines are 5-methyluridines, between about 50% and about 100% of the cytidines are 5-methylcytidines, and between about 20% and about 80% of the guanosines are 7-deazaguanosines. 
     
     
         7 . The synthetic RNA molecule of  claim 1 , further comprising a 5′-cap structure. 
     
     
         8 . The synthetic RNA molecule of  claim 7 , wherein the 5′-cap structure is the Cap 1 structure. 
     
     
         9 . The synthetic RNA molecule of  claim 1 , further comprising a 3′-poly(A) tail. 
     
     
         10 . The synthetic RNA molecule of  claim 1 , further comprising a UTR. 
     
     
         11 . The synthetic RNA molecule of  claim 1 , further comprising a strong Kozak sequence. 
     
     
         12 . The synthetic RNA molecule of  claim 1 , wherein the synthetic RNA molecule encodes a reprogramming protein. 
     
     
         13 . The synthetic RNA molecule of  claim 12 , wherein the reprogramming protein is selected from Oct4 protein, Sox2 protein, Klf4 protein, c-Myc protein, or Lin28 protein. 
     
     
         14 . The synthetic RNA molecule of  claim 1 , wherein the synthetic RNA molecule encodes a gene-editing protein. 
     
     
         15 . The synthetic RNA molecule of  claim 14 , wherein the gene-editing protein comprises a DNA binding domain and the catalytic domain of a DNA endonuclease or a biologically active fragment thereof. 
     
     
         16 . The synthetic RNA molecule of  claim 14 , wherein the gene-editing protein comprises at least one of: a zinc-finger nuclease, a transcription activator-like effector nuclease, a nuclease, a meganuclease, a nickase, and a clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein or a biologically active fragment or variant thereof. 
     
     
         17 . A nucleic acid encoding a gene-editing protein, wherein the gene-editing protein targets a member of: TERT, TERC, HBB, BRCA1, BRCA2, CCR5, CFTR, CXCR4, DDB2, DMD, EGFR, ERCC4, ERCC5, ERCC6, F9, F8, F11, SLC40A1, HAMP, HEXA, HFE, HJV, the JAK family, the MYC family, NF1, NF2, TP53, POLH, RAD2, PKN3, the RAS family, BIRC5, TFR2, XPA, XPB, XPC, XPD, Rosa26, AAVS1, FBN1, HTT, APP, PSEN1, PSEN2, APOE, SNCA, PRKN, LRRK2, CR1, CLU, PICALM, BIN1, MS4A4, MS4A6E, CD2AP, CD33, EPHA1, PINK1, PARK7, ATP13A2, HNPCC1, HNPCC2, HNPCC5, FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ, FANCL, FANCM, FANCN, FANCP, RAD51C, the VEGF family, GCK, HNF1A, HNF4A, HNF1B, SOD1, PTEN, RET, KIT, MET, APC, RB1, and TNF or a variant thereof. 
     
     
         18 . The synthetic RNA molecule of  claim 14 , wherein the gene-editing protein reduces the expression of one or more proteins. 
     
     
         19 . A nucleic acid encoding a gene-editing protein, wherein the gene-editing protein produces a gene that encodes a non-functional protein. 
     
     
         20 . A nucleic acid encoding a gene-editing protein, wherein the gene-editing protein produces a gene that encodes a dominant-negative protein. 
     
     
         21 . A nucleic acid encoding a gene-editing protein, wherein the gene-editing protein targets a sequence that is not present in the non-cancer human genome. 
     
     
         22 . A nucleic acid encoding a gene-editing protein, wherein the gene-editing protein targets a member of: a viral sequence, a bacterial sequence, a fungal sequence, a parasite sequence, and a cancer-genome sequence. 
     
     
         23 . The nucleic acid of  claim 17 , wherein the gene-editing protein targets at least one of: TTGCCCCCTGCCTGGCAGCC and TTCTTGAATGTAGAGATGCG. 
     
     
         24 . A synthetic RNA molecule encoding a gene-editing protein comprising at least one of: pseudouridine, 5-methylpseudouridine, 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, N4-methylcytidine, N4-acetylcytidine, and 7-deazaguanosine or a derivative thereof. 
     
     
         25 . A nucleic acid encoding a gene-editing protein, wherein the gene-editing protein reduces the expression of a survivin protein. 
     
     
         26 . A nucleic acid encoding a gene-editing protein, wherein the gene-editing protein produces a gene that encodes a non-functional variant of a survivin protein. 
     
     
         27 . A nucleic acid encoding a gene-editing protein, wherein the gene-editing protein produces a gene that encodes a dominant-negative variant of a survivin protein. 
     
     
         28 . A therapeutic composition comprising the synthetic RNA molecule of  claim 1  or the nucleic acid of  claim 17 . 
     
     
         29 . The therapeutic composition of  claim 28 , further comprising a delivery reagent. 
     
     
         30 . The therapeutic composition of  claim 29 , wherein the delivery reagent comprises a lipid. 
     
     
         31 . The therapeutic composition of  claim 29 , wherein the delivery reagent comprises a polyethylene glycol or a derivative thereof. 
     
     
         32 . The therapeutic composition of  claim 28 , wherein the therapeutic composition is prepared as a sterile, aqueous suspension of particles. 
     
     
         33 . The therapeutic composition of  claim 32 , wherein the particles are liposomes. 
     
     
         34 . The therapeutic composition of  claim 28 , further comprising a second synthetic RNA molecule or nucleic acid. 
     
     
         35 . The therapeutic composition of  claim 28 , further comprising a repair template. 
     
     
         36 . A method of treating cancer, comprising administering an effective amount of the therapeutic composition of  claim 28  to a patient in need thereof. 
     
     
         37 . The method of  claim 36 , wherein the cancer includes at least one of: prostate cancer, colon cancer, breast cancer, lung cancer, skin cancer, brain cancer, leukemia, pancreatic cancer, liver cancer, bladder cancer, stomach cancer, bone cancer, testicular cancer, sarcoma, carcinoma, throat cancer, renal cancer, lymphoma, heart cancer, cervical cancer, ovarian cancer, eye cancer, uterine cancer, ductal cancer, gall bladder cancer, oral cancer, neck cancer, mesothelioma, nasal cancer, sinus cancer, penile cancer, anal cancer, salivary gland cancer, small-intestine cancer, thyroid cancer, urethral cancer, vaginal cancer, and vulvar cancer. 
     
     
         38 . A method for inducing a cell to express a protein of interest, comprising contacting the cell with the synthetic RNA molecule of  claim 1  or the nucleic acid of  claim 17 . 
     
     
         39 . A cell produced by the method of  claim 38 . 
     
     
         40 . An organism produced by implanting the cell of  claim 39  into a blastocyst or a uterus. 
     
     
         41 . The organism of  claim 40 , wherein the organism is selected from rat, mouse, rabbit, guinea pig, primate, pig, cow, chicken, goat, donkey, cat, dog, and zebrafish. 
     
     
         42 . The organism of  claim 40 , wherein the cell is further contacted with a nucleic acid encoding a human gene or fragment thereof. 
     
     
         43 . The organism of  claim 42 , wherein the human gene is inserted into the genome of the organism. 
     
     
         44 . The organism of  claim 40 , wherein the gene-editing protein targets one or more endogenous orthologues of the human gene. 
     
     
         45 . The organism of  claim 44 , wherein the one or more endogenous orthologues is inactivated. 
     
     
         46 . The cell of  claim 39 , wherein the cell is further differentiated into a member of: a skin cell, a glucose-responsive insulin-producing cell, a hematopoietic cell, a cardiac cell, a retinal cell, a renal cell, a neural cell, a stromal cell, a fat cell, a bone cell, a muscle cell, an oocyte, and a sperm cell. 
     
     
         47 . The cell of  claim 39 , wherein the cell is cultured in a high-throughput screening-compatible format. 
     
     
         48 . The cell of  claim 47 , wherein the format is a multi-well plate. 
     
     
         49 . A therapeutic composition comprising the cell of  claim 39 . 
     
     
         50 . A composition for altering the DNA sequence of a living cell, comprising a nucleic acid, encoding a gene-editing protein, wherein the gene-editing protein comprises:
 a. a DNA-binding domain, and   b. a nuclease domain,   
       wherein the DNA-binding domain comprises a plurality of repeat sequences, at least two of the repeat sequences having at least 50% homology to each other, and at least one of the repeat sequences containing one or more regions capable of binding to a binding site in a target DNA molecule, the binding site containing a defined sequence of between 1 and 5 bases in length, and the nuclease domain comprises the catalytic domain of a protein selected from StsI, StsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF, StsI-UHF or a biologically active fragment thereof. 
     
     
         51 . A composition for altering the DNA sequence of a living cell comprising a nucleic-acid mixture comprising:
 a. a first nucleic acid that encodes a first gene-editing protein, and   b. a second nucleic acid that encodes a second gene-editing protein,   
       wherein the first gene-editing protein or the second gene-editing protein or both the first gene-editing protein and the second gene-editing protein comprises:
 i. a DNA-binding domain, and 
 ii. a nuclease domain, 
 
       wherein the DNA-binding domain comprises a plurality of repeat sequences, at least two of the repeat sequences having at least 50% homology to each other, and at least one of the repeat sequences containing one or more regions capable of binding to a binding site in a target DNA molecule, the binding site containing a defined sequence of between 1 and 5 bases in length, and the nuclease domain comprises the catalytic domain of a protein selected from FokI, StsI, StsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF, StsI-UHF or a biologically active fragment thereof. 
     
     
         52 . A method for modifying the genome of a cell, comprising introducing into the cell a nucleic acid molecule encoding a non-naturally occurring fusion protein comprising an artificial transcription activator-like (TAL) effector repeat domain comprising one or more repeat units 36 amino acids in length and an endonuclease domain, wherein the repeat domain is engineered for recognition of a predetermined nucleotide sequence, wherein the fusion protein recognizes the predetermined nucleotide sequence. 
     
     
         53 . The method of  claim 52 , wherein the cell is a eukaryotic cell. 
     
     
         54 . The method of  claim 52 , wherein the cell is an animal cell. 
     
     
         55 . The method of  claim 52 , wherein the cell is a mammalian cell. 
     
     
         56 . The method of  claim 52 , wherein the cell is a human cell. 
     
     
         57 . The method of  claim 52 , wherein the cell is a plant cell. 
     
     
         58 . The method of  claim 52 , wherein the cell is a prokaryotic cell. 
     
     
         59 . The method of  claim 52 , wherein the fusion protein introduces an endonucleolytic cleavage in a nucleic acid of the cell, whereby the genome of the cell is modified. 
     
     
         60 . A nucleic acid molecule encoding a non-naturally occurring fusion protein, comprising an artificial transcription activator-like (TAL) effector repeat domain comprising one or more repeat units 36 amino acids in length and restriction endonuclease activity, wherein the repeat domain is engineered for recognition of a predetermined nucleotide sequence and wherein the fusion protein recognizes the predetermined nucleotide sequence. 
     
     
         61 . The nucleic acid molecule of  claim 60 , wherein each of the repeat units differ by no more than seven amino acids. 
     
     
         62 . The nucleic acid molecule of  claim 60 , wherein each of the repeat units contain the amino acid sequence: LTPXQVVAIAS where X can be either E or Q, and wherein the amino acid sequence LTPXQVVAIAS is followed on the carboxyl terminus by either one or two amino acids that determine recognition for one of adenine, cytosine, guanine or thymine. 
     
     
         63 . The nucleic acid of  claim 60 , encoding about 1.5 to about 28.5 repeat units. 
     
     
         64 . The nucleic acid molecule of  claim 60 , encoding about 11.5, about 14.5, about 17.5 or about 18.5 repeat units. 
     
     
         65 . The nucleic acid molecule of  claim 60 , wherein the predetermined nucleotide sequence is a promoter region. 
     
     
         66 . A vector containing the nucleic acid molecule of  claim 60 . 
     
     
         67 . The vector of  claim 66 , wherein the vector is a viral vector. 
     
     
         68 . The viral vector of  claim 67 , wherein the vector comprises one or more of an adenovirus, a retrovirus, a lentivirus, a herpes virus, an adeno-associated virus, and an engineered virus. 
     
     
         69 . A nucleic acid molecule encoding a non-naturally occurring fusion protein, comprising a first region that recognizes a predetermined nucleotide sequence and a second region with endonuclease activity, wherein the first region contains an artificial TAL effector repeat domain comprising one or more repeat units 36 acids in length which differ from each other by no more than seven amino acids, wherein the repeat domain is engineered for recognition of the predetermined nucleotide sequence. 
     
     
         70 . The nucleic acid molecule of  claim 69 , wherein the first region contains the amino acid sequence: LTPXQVVAIAS where X can be either E or Q. 
     
     
         71 . The nucleic acid molecule of  claim 70 , wherein the amino acid sequence LTPXQVVAIAS of the encoded non-naturally occurring fusion protein is immediately followed by an amino acid sequence selected from the group consisting of: HD, NG, NS, NI, NN, and N. 
     
     
         72 . The nucleic acid molecule of  claim 69 , wherein the fusion protein comprises restriction endonuclease activity. 
     
     
         73 . A vector containing the nucleic acid molecule of  claim 69 . 
     
     
         74 . The vector of  claim 73 , wherein the vector is a viral vector. 
     
     
         75 . The viral vector of  claim 74 , wherein the vector comprises one or more of an adenovirus, a retrovirus, a lentivirus, a herpes virus, an adeno-associated virus, and an engineered virus. 
     
     
         76 . A nucleic acid molecule encoding a protein that comprises one or more sequences selected from SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, and SEQ ID NO: 60. 
     
     
         77 . The composition of  claim 50 , wherein the nucleic acid further comprises a nuclear-localization sequence. 
     
     
         78 . The composition of  claim 77 , wherein the nuclear-localization sequence includes the amino-acid sequence PKKKRKV. 
     
     
         79 . The composition of  claim 50 , wherein the nucleic acid further comprises a mitochondrial-localization sequence. 
     
     
         80 . The composition of  claim 30 , wherein the mitochondrial-localization sequence includes the amino-acid sequence LGRVIPRKIASRASLM. 
     
     
         81 . The composition of  claim 50 , wherein the DNA-binding domain and the nuclease domain are separated by a linker. 
     
     
         82 . The composition of  claim 81 , wherein the linker is between about 1 to about 10 amino acids long. 
     
     
         83 . A gene-editing protein comprising a plurality of repeat sequences, wherein the plurality of repeat sequences comprises at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwxyzGHGG, wherein “v” is Q, D or E, “w” is S or N, “x” is N, H or I, “y” is any amino acid or no amino acid, and “z” is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD or GKQALETVQRLLPVLCQA. 
     
     
         84 . The gene-editing protein of  claim 83 , wherein the plurality of repeat sequences includes at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwxyzGHGG, wherein “v” is Q, D or E, “w” is S or N, “x” is N, H or I, “y” is selected from: D, A, I, N, H, K, S, and G, and “z” is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD or GKQALETVQRLLPVLCQA. 
     
     
         85 . The gene-editing protein of  claim 83 , wherein the plurality of repeat sequences includes at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwxyzGHGG, wherein “v” is Q, D or E, “w” is S or N, “x” is any amino acid other than N, H and I, “y” is any amino acid or no amino acid, and “z” is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD or GKQALETVQRLLPVLCQA. 
     
     
         86 . The gene-editing protein of  claim 83 , wherein the plurality of repeat sequences includes at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwIyzGHGG, wherein “v” is Q, D or E, “w” is S or N, “y” is any amino acid other than G, and “z” is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD or GKQALETVQRLLPVLCQA. 
     
     
         87 . The gene-editing protein of  claim 83 , wherein the plurality of repeat sequences includes at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwIAzGHGG, wherein “v” is Q, D or E, “w” is S or N, and “z” is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD or GKQALETVQRLLPVLCQA. 
     
     
         88 . The gene-editing protein of  claim 83 , wherein the plurality of repeat sequences includes at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwxyzGHGG, wherein “v” is Q, D or E, “w” is S or N, “x” is S, T or Q, “y” is any amino acid or no amino acid, and “z” is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD or GKQALETVQRLLPVLCQA. 
     
     
         89 . The gene-editing protein of  claim 83 , wherein the plurality of repeat sequences includes at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwxyzGHGG, wherein “v” is Q, D or E, “w” is S or N, “x” is S, T or Q, “y” is selected from: D, A, I, N, H, K, S, and G, and “z” is GGRPALE, GGKQALE, GGKQALETVQRLLPVLCQD, GGKQALETVQRLLPVLCQA, GKQALETVQRLLPVLCQD or GKQALETVQRLLPVLCQA. 
     
     
         90 . The gene-editing protein of  claim 83 , wherein the plurality of repeat sequences includes at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwx, wherein “v” is Q, D or E, “w” is S or N, and “x” is S, T or Q. 
     
     
         91 . The gene-editing protein of  claim 83 , wherein the plurality of repeat sequences includes at least one repeat sequence that comprises the amino acid sequence: LTPvQVVAIAwxy, wherein “v” is Q, D or E, “w” is S or N, “x” is S, T or Q, and “y” is selected from: D, A, I, N, H, K, S, and G. 
     
     
         92 . The composition of  claim 51 , wherein the binding site of the first gene-editing protein and the binding site of the second gene-editing protein are present in the same target DNA molecule. 
     
     
         93 . The composition of  claim 92 , wherein the binding site of the first gene-editing protein and the binding site of the second gene-editing protein are separated by no more than about 50 bases. 
     
     
         94 . The composition of  claim 50 , wherein the gene-editing protein is capable of generating a nick or double-strand break in the target DNA molecule. 
     
     
         95 . The composition of  claim 51 , wherein the nuclease domain of the first gene-editing protein and the nuclease domain of the second gene-editing protein are capable of forming a dimer, and the dimer is capable of generating a nick or double-strand break in the target DNA molecule. 
     
     
         96 . The composition of  claim 50 , wherein the plurality of repeat sequences includes at least one repeat sequence having at least about 50% homology to a transcription activator-like effector monomer. 
     
     
         97 . The composition of  claim 50 , wherein the plurality of repeat sequences includes at least one zinc finger monomer. 
     
     
         98 . The composition of  claim 50 , wherein the nucleic acid is a synthetic RNA molecule. 
     
     
         99 . The composition of  claim 98 , wherein the synthetic RNA molecule comprises at least one of pseudouridine, 5-methylpseudouridine, 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, N4-methylcytidine, N4-acetylcytidine, and 7-deazaguanosine. 
     
     
         100 . An article of manufacture for synthesizing a gene-editing protein or nucleic-acid encoding a gene-editing protein comprising a nucleic acid, wherein the nucleic acid comprises:
 a. a nucleotide sequence encoding a DNA-binding domain, and   b. a nucleotide sequence encoding a nuclease domain,   
       wherein the DNA-binding domain comprises a plurality of repeat sequences, at least two of the repeat sequences having at least about 50% homology to each other, and at least one of the repeat sequences containing one or more regions capable of binding to a binding site in a target DNA molecule, the binding site containing a defined sequence of between about 1 and about 5 bases in length, and the nuclease domain comprises the catalytic domain of a protein selected from: FokI, StsI, StsI-HA, StsI-HA2, StsI-UHA, StsI-UHA2, StsI-HF, StsI-UHF or a biologically active fragment thereof. 
     
     
         101 . The article of  claim 100 , wherein the nucleic acid further comprises an RNA-polymerase promoter. 
     
     
         102 . The article of  claim 101 , wherein the RNA polymerase promoter is selected from a T7 promoter and a SP6 promoter. 
     
     
         103 . The article of  claim 100 , wherein the nucleic acid further comprises a viral promoter. 
     
     
         104 . The article of  claim 100 , wherein the nucleic acid further comprises an untranslated region. 
     
     
         105 . The article of  claim 100 , wherein the nucleic acid is an in vitro-transcription template. 
     
     
         106 . A method for inducing a living cell to express a gene-editing protein, comprising transfecting the cell with the composition of  claim 50 . 
     
     
         107 . A method for altering the DNA sequence of a living cell, comprising transfecting a cell with the composition of  claim 50 . 
     
     
         108 . A method for reducing the expression of a protein of interest in a living cell comprising transfecting the cell with the composition of  claim 50 , wherein the target DNA molecule encodes the protein of interest. 
     
     
         109 . A method for altering the DNA sequence of a living cell to generate an inactive, reduced-activity or dominant-negative version of a protein of interest comprising transfecting the cell with the composition of  claim 50 , wherein the target DNA molecule encodes the protein of interest, and resulting in the cell generating an inactive, reduced-activity or dominant-negative version of the protein. 
     
     
         110 . The method of  claim 109 , wherein the protein of interest is survivin. 
     
     
         111 . A method for treating a patient comprising administering to the patient a therapeutically effective amount of the composition of  claim 50 , and resulting in one or more of the patient's symptoms being ameliorated. 
     
     
         112 . A method for treating cancer comprising administering to a patient a therapeutically effective amount of the composition of  claim 50 , and resulting in the growth of cancer cells in the patient being reduced and/or halted. 
     
     
         113 . The composition of  claim 50 , wherein the target DNA molecule comprises the BIRC5 gene. 
     
     
         114 . A composition for altering the DNA sequence of a living cell comprising a gene-editing protein, wherein the gene-editing protein is capable of binding to a sequence having at least 50% homology with a sequence selected from: SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15. 
     
     
         115 . A composition for altering the DNA sequence of a living cell comprising a gene-editing protein, wherein the gene-editing protein is capable of binding to one or more binding sites, and wherein a plurality of the binding sites are at least 50% homologous to two or more of: SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27. 
     
     
         116 . The composition of  claim 50 , further comprising a repair template. 
     
     
         117 . A method for treating a patient comprising:
 a. removing a cell from the patient,   b. inducing the cell to express a gene-editing protein by transfecting the cell with the composition of  claim 50 ,   c. reprogramming the cell by transfecting the cell with one or more nucleic acids encoding one or more reprogramming proteins,   d. differentiating the cell into one of a skin cell, a glucose-responsive insulin-producing cell, a hematopoietic cell, a cardiac cell, a retinal cell, a renal cell, a neural cell, a stromal cell, a fat cell, a bone cell, a muscle cell, an oocyte, and a sperm cell, and   e. introducing the cell into the patient.   
     
     
         118 . A method for treating a patient comprising:
 a. removing a hematopoietic cell or stem cell from the patient,   b. inducing the cell to express a gene-editing protein by transfecting the cell with the composition of  claim 50 , and   c. introducing the cell into the patient.   
     
     
         119 . A method for treating cancer, comprising:
 a. removing a biopsy containing one or more cancerous cells from a patient,   b. determining the sequence of a cancer-associated genetic marker in the one or more cancerous cells, and   c. administering to the patient a therapeutically effective amount of the composition of  claim 50 , wherein the sequence of the target DNA molecule is at least about 50% homologous to the sequence of the cancer-associated genetic marker.   
     
     
         120 . The method of  claim 119 , further comprising comparing the sequence of one or more cancer-associated genetic markers in the one or more cancerous cells to the sequence of the same cancer-associated genetic markers in one or more non-cancerous cells, selecting a cancer-associated genetic marker having a sequence that is different in the one or more cancerous cells and the one or more non-cancerous cells, and wherein the sequence of the target DNA molecule is at least about 50% homologous to the sequence of the selected cancer-associated genetic marker. 
     
     
         121 . A method for treating a neurodegenerative disease comprising administering to a patient a therapeutically effective amount of a gene-editing protein or a nucleic acid encoding a gene-editing protein, wherein the gene-editing protein is capable of binding to a nucleotide sequence that encodes a protein that forms disease-associated plaques, and resulting in delayed or halted progression of the disease and/or reduction of disease-associated plaques in the patient. 
     
     
         122 . The method of  claim 121 , wherein the nucleotide sequence comprises the SNCA gene. 
     
     
         123 . The method of  claim 121 , wherein the nucleotide sequence encodes α-synuclein. 
     
     
         124 . The method of  claim 121 , wherein the neurodegenerative disease is selected from Parkinson's disease, Alzheimer's disease, and dementia. 
     
     
         125 . A kit for altering the DNA sequence of a living cell comprising the composition of  claim 50 . 
     
     
         126 . A kit for altering the DNA sequence of a living human cell comprising the composition of  claim 50 , wherein the target DNA molecule comprises a nucleotide sequence that encodes the AAVS1 locus. 
     
     
         127 . A kit for altering the DNA sequence of a living rodent cell comprising the composition of  claim 50 , wherein the target DNA molecule comprises a nucleotide sequence that encodes the Rosa26 locus. 
     
     
         128 . A method for identifying a disease-causing toxicant, comprising transfecting a living cell with a gene-editing protein or a nucleic acid encoding a gene-editing protein to alter the DNA sequence of the cell, wherein the altered DNA sequence confers susceptibility to a disease, contacting the cell with a suspected disease-causing toxicant, and assessing the degree to which the cell exhibits a phenotype associated with the disease. 
     
     
         129 . The method of  claim 128 , wherein the disease is a neurodegenerative disease, autoimmune disease, respiratory disease, reproductive disorder, or cancer. 
     
     
         130 . A method for assessing the safety of a therapeutic substance comprising transfecting a living cell with a gene-editing protein or a nucleic acid encoding a gene-editing protein to alter the DNA sequence of the cell, wherein the altered DNA sequence confers susceptibility to one or more toxic effects of the therapeutic substance, contacting the cell with the therapeutic substance, and measuring one or more toxic effects of the therapeutic substance on the cell. 
     
     
         131 . A method for assessing the effectiveness of a therapeutic substance comprising transfecting a living cell with a gene-editing protein or a nucleic acid encoding a gene-editing protein to alter the DNA sequence of the cell, wherein the altered DNA sequence causes the cell to exhibit one or more disease-associated phenotypes, contacting the cell with the therapeutic substance, and measuring the degree to which the one or more disease-associated phenotypes are reduced. 
     
     
         132 . A method for treating an infectious disease comprising administering to a patient a therapeutically effective amount of a gene-editing protein or a nucleic acid encoding a gene-editing protein, wherein the gene-editing protein is capable of binding to one or more nucleotide sequences that are present in the infectious agent. 
     
     
         133 . The method of  claim 112 , wherein the cancer is glioma. 
     
     
         134 . The method of  claim 112 , wherein the patient has previously undergone surgery or radiation therapy for the removal of cancer. 
     
     
         135 . The method of  claim 112 , wherein the administering is by one or more of: intrathecal injection, intracranial injection, intravenous injection, perfusion, subcutaneous injection, intraperitoneal injection, intraportal injection, and topical delivery. 
     
     
         136 . The method of  claim 111 , wherein the patient is diagnosed with a proteopathy. 
     
     
         137 . The kit of  claim 125 , further comprising a repair template. 
     
     
         138 . The kit of  claim 137 , wherein the repair template contains a multiple cloning site. 
     
     
         139 . A method for expressing a protein of interest in a cell by contacting the cell with a synthetic RNA molecule comprising 5-methyluridine, 7-deazaguanosine, and at least one of: 5-methylcytidine, 5-hydroxymethylcytidine, N4-methylcytidine, and N4-acetylcytidine. 
     
     
         140 . The method of  claim 139 , wherein the synthetic RNA molecule comprises uridine residues, and about 40% of the uridine residues are 5-methyluridine residues. 
     
     
         141 . The method of  claim 139 , wherein the synthetic RNA molecule comprises cytidine residues, and between about 40% and about 100% of the cytidine residues are selected from: 5-methylcytidine residues, 5-hydroxymethylcytidine residues, N4-methylcytidine residues, and N4-acetylcytidine residues. 
     
     
         142 . The method of  claim 139 , wherein the synthetic RNA molecule comprises guanosine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues. 
     
     
         143 . A nucleic acid encoding a protein of interest comprising 5-methyluridine, 7-deazaguanosine, and at least one of: 5-methylcytidine, 5-hydroxymethylcytidine, N4-methylcytidine, and N4-acetylcytidine. 
     
     
         144 . A method for increasing homologous recombination in a cell comprising:
 a. contacting the cell with a NHEJ inhibitor,   b. transfecting the cell with one or more nucleic acids encoding one or more gene-editing proteins, wherein at least one of the one or more gene-editing proteins binds to a target region, and   c. transfecting the cell with one or more nucleic acids having at least 50% homology to the target region.   
     
     
         145 . The method of  claim 144 , wherein the NHEJ inhibitor is a DNA-PK inhibitor. 
     
     
         146 . The method of  claim 144 , wherein the DNA-PK inhibitor is a member of: Compound 401 (2-(4-Morpholinyl)-4H-pyrimido[2,1-a] isoquinolin-4-one), DMNB, IC87361, LY294002, NU7026, NU7441, OK-1035, PI 103 hydrochloride, vanillin, and wortmannin or a derivative thereof. 
     
     
         147 . A method for treating Duchenne muscular dystrophy, comprising administering to a patient one or more gene-editing proteins or a nucleic acid encoding one or more gene-editing proteins, wherein the one or more gene-editing proteins target a sequence within the DMD gene. 
     
     
         148 . The method of  claim 147 , wherein the treatment results in the production of a truncated form of DMD protein. 
     
     
         149 . The method of  claim 147 , wherein the target sequence is within about 1 kb of a splice acceptor site.

Join the waitlist — get patent alerts

Track US2022243228A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.