US2022228215A1PendingUtilityA1

Method of Determining Disease Causality of Genome Mutations

Assignee: HOSPITAL FOR SICK CHILDRENPriority: Oct 18, 2013Filed: Dec 6, 2021Published: Jul 21, 2022
Est. expiryOct 18, 2033(~7.2 yrs left)· nominal 20-yr term from priority
G16B 20/10G16B 20/00G16B 20/20C12Q 1/6883C12Q 2600/156G16B 30/00G16B 20/40C12Q 2600/158
67
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A method of identifying a gene or genomic mutation that is linked to causality of a neuropsychiatric disorder is provided. The method comprises identifying exons which exhibit an expression level that is at least within the 75th percentile of exon expression levels within a nucleic acid-containing sample from a mammal having a neuropsychiatric disorder; comparing the sequence of each identified exon to the sequence of a corresponding exon from a healthy control to identify rare or de novo sequence mutations within the identified exon; calculating the burden of rare or de novo mutations within the exon; and determining the correlation between expression level of the identified exon and burden of de novo or rare mutations in the exon, wherein an inverse correlation indicates that the exon gene is linked to causality of the neuropsychiatric disorder.

Claims

exact text as granted — not AI-modified
1 . A method of detecting a critical exon associated with a disease in a nucleic acid sample from a mammal, comprising the steps of: 
       i) detecting exons within target genes in the nucleic acid sample which exhibit an expression level greater than the 75th percentile of exon expression levels in genes from one or more mammals having the disease using nucleic acid primers that target exons within the target genes; 
       ii) detecting rare mutations which occur at a frequency of less than 0.05 or de novo sequence mutations not possessed by either parent of the nucleic acid sample within each exon detected in step i) and determining the burden of mutation of each exon by dividing the number of mutations in each exon by the length of the exon; and 
       iii) identifying an exon as a critical exon when the burden of mutation of the exon is less than the 75 th  percentile of mutations in the exon and inversely correlates with the exon expression level. 
     
     
         2 . The method of  claim 1 , wherein the disease is a pathological condition in a developmental process of the central nervous system, brain, heart, kidney or lungs. 
     
     
         3 . The method of  claim 1 , wherein the disease involves a developmental process of the brain. 
     
     
         4 . The method of  claim 1 , wherein the nucleic acid-containing sample is selected from neocortex, amygdala, cerebellar cortex, hippocampus, mediodorsal nucleus of the thalamus, and striatum. 
     
     
         5 . The method of  claim 4 , wherein the sample is a cerebellar cortex sample. 
     
     
         6 . The method of  claim 1 , wherein the sample is a prenatal, child or adult sample. 
     
     
         7 . The method of  claim 1 , wherein the rare or de novo mutations are selected from the group of missense, frameshift, nonsense, splice-site variants and copy number variations. 
     
     
         8 . The method of  claim 7 , wherein the mutations are missense mutations. 
     
     
         9 . The method of  claim 1 , additionally comprising conducting a gene co-expression analysis before step i) to detect in the sample genes that encode proteins relevant to the disease for analysis in step i). 
     
     
         10 . The method of  claim 9 , wherein the co-expression analysis is a Weighted Gene Co-expression Network Analysis. 
     
     
         11 . The method of  claim 1 , wherein the nucleic acid sample is obtained from one or more of the neocortex, amygdala (AMY), cerebellar cortex (CBC), hippocampus (HIP), mediodorsal nucleus of the thalamus (MD) and striatum (STR). 
     
     
         12 . The method of  claim 11 , wherein the expression level of Fragile X mental retardation target (FMRP) genes, Forkhead box P2 (FOXP2) target genes, post-synaptic proteome (PSP) target genes and/or autism spectral disorder (ASD) target genes is determined in step i). 
     
     
         13 . A method of detecting a critical exon associated with a disease which is a neuropsychiatric disorder selected from Autism Spectral disorder (ASD), schizophrenia (SZ), intellectual disability (ID), Fragile X syndrome, epilepsy and nervous disorders in a nucleic acid sample from a mammal, comprising the steps of: 
       i) detecting exons within target genes in the nucleic acid sample which exhibit an expression level greater than the 75th percentile of exon expression levels in genes from one or more mammals having the disease using nucleic acid primers that target exons within target genes selected from the group consisting of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 1) 
                 
                     
                   TGACATCGCACGTCCATCTG 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 2) 
                 
                     
                   ACAGGTAGTAAATGGCCCAGG; 
                 
                     
                 
                     
                   (SEQ ID NO: 3) 
                 
                     
                   GAGCCTTCCTGATCCCCTAT 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 4) 
                 
                     
                   ACTGTTTCCACGGCAGTGT; 
                 
                     
                 
                     
                   (SEQ ID NO: 1) 
                 
                     
                   TGACATCGCACGTCCATCTG 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 4) 
                 
                     
                   ACTGTTTCCACGGCAGTGT; 
                 
                     
                 
                     
                   (SEQ ID NO: 5) 
                 
                     
                   CGGCTGCTGTGCTATCATTC 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 6) 
                 
                     
                   CAGCCAACACCCTTCCAGAT; 
                 
                     
                 
                     
                   (SEQ ID NO: 3) 
                 
                     
                   GAGCCTTCCTGATCCCCTAT 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 6) 
                 
                     
                   CAGCCAACACCCTTCCAGAT; 
                 
                     
                 
                     
                   (SEQ ID NO: 7) 
                 
                     
                   GGCTGGATAAGCCAGGTCAG 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 8) 
                 
                     
                   GGAAAGAGTTGTAGCTCCCGA; 
                 
                     
                 
                     
                   (SEQ ID NO: 9) 
                 
                     
                   CCTGTTCTTCCGTGGAGTGA 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 10) 
                 
                     
                   CATGAAGCCCACGATGGAGA; 
                 
                     
                 
                     
                   (SEQ ID NO: 11) 
                 
                     
                   GGCTGGATAAGCCAGGTCAG 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 12) 
                 
                     
                   TACTCATCCACCAGGGCTGT; 
                 
                     
                 
                     
                   (SEQ ID NO: 13) 
                 
                     
                   CCTCAACAGACACTGCCGTA 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 14) 
                 
                     
                   GTCTCCCGCCGAGTAAGAAG; 
                 
                     
                 
                     
                   (SEQ ID NO: 15) 
                 
                     
                   CCTCATCCCCATGGTGACATC 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 16) 
                 
                     
                   TTACTGCGGTTGTGCAGGAG; 
                 
                     
                 
                     
                   (SEQ ID NO: 17) 
                 
                     
                   GACTTTGTCTTCGCCCCAGA 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 18) 
                 
                     
                   CTACCATCAAGCCGTCCCTG; 
                 
                     
                 
                     
                   (SEQ ID NO: 19) 
                 
                     
                   TCCGACATTCTCACTTGCCA 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 20) 
                 
                     
                   CCAGGGTCAGCACAAGTCAT; 
                 
                     
                 
                     
                   (SEQ ID NO: 21) 
                 
                     
                   GGACTGTTCTCTGCTGGGAC 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 22) 
                 
                     
                   GTTCGGAACCAGTACTCGCC; 
                 
                     
                 
                     
                   (SEQ ID NO: 23) 
                 
                     
                   CCGCATCCTGATGTGTCTGA 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 24) 
                 
                     
                   TTGCAGGTGGATACGTGACT; 
                 
                     
                 
                     
                   (SEQ ID NO: 25) 
                 
                     
                   TTC ATC CCA ATT CAG GAG AC 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 26) 
                 
                     
                   CAT GAT CCG AAT GTC ACA AA; 
                 
                     
                 
                     
                   (SEQ ID NO: 27) 
                 
                     
                   AGC AGG TTT CTC ACT GGT TA 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ED NO: 28) 
                 
                     
                   GAT GCT GTC ATT CCA AGA GC; 
                 
                     
                 
                     
                   (SEQ ED NO: 29) 
                 
                     
                   GCC TTG ACT TAT CCG AAT TG 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 30) 
                 
                     
                   ACC TCG TCA TAC ACG TCC A; 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ID NO: 31) 
                 
                     
                   ATT GCC GAC AGG ATG CAG A 
                 
                     
                   and 
                 
                     
                 
                     
                   (SEQ ED NO: 32) 
                 
                     
                   GAG TAC TTG CGC TCA GGA GGA. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       ii) detecting rare mutations which occur at a frequency of less than 0.05 or de novo sequence mutations not possessed by either parent of the nucleic acid sample within each exon detected in step i) and determining the burden of mutation of each exon by dividing the number of mutations in each exon by the length of the exon; and 
       iii) identifying an exon as a critical exon when the burden of mutation of the exon is less than the 75 th  percentile of mutations in the exon and inversely correlates with the exon expression level. 
     
     
         14 . The method of  claim 13 , wherein the nucleic acid-containing sample is selected from neocortex, amygdala, cerebellar cortex, hippocampus, mediodorsal nucleus of the thalamus, and striatum. 
     
     
         15 . The method of  claim 13 , wherein the sample is a prenatal, child or adult sample. 
     
     
         16 . The method of  claim 13 , wherein the rare or de novo mutations are selected from the group of missense, frameshift, nonsense, splice-site variants and copy number variations. 
     
     
         17 . The method of  claim 13 , additionally comprising conducting a gene co-expression analysis to identify genes encoding proteins relevant to the disease for analysis in step i). 
     
     
         18 . The method of  claim 17 , wherein the co-expression analysis is a Weighted Gene Co-expression Network Analysis. 
     
     
         19 . A computer program product, comprising a tangible computer-readable medium carrying computer-usable instructions which, when executed by a processing unit of a computer, cause the processing unit to identify one or more critical exons associated with a disease in a mammal according to the method defined in  claim 1 . 
     
     
         20 . A computer system for use to identify one or more critical exons associated with a disease in a mammal, comprising:
 a memory for storing instructions; and   at least one processing unit coupled to the memory for executing the instructions stored in the memory, wherein the instructions, when executed by the at least one processing unit, cause the computer system to conduct the steps of the method defined in  claim 1 .

Join the waitlist — get patent alerts

Track US2022228215A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.