Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

What is claimed is: 
     
         1 . A bacterial cell comprising a chimeric Cas9 protein comprising a Cas9 polypeptide fused to a transcriptional activator polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         2 . A composition comprising:
 a buffer; and   a single-molecule DNA-targeting RNA, or a DNA encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA has the structure:   
       
         
           
           
               
               
           
         
       
       wherein the linker is nnnn such that the single-molecule DNA-targeting RNA has the nucleotide sequence nnnnnnnnnnnnnnnnnnnnGUUUUAGAGCUAnnnnUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 680). 
     
     
         3 . The composition of  claim 2 , wherein the linker is GAAA such that the single-molecule DNA-targeting RNA has the structure: 
       
         
           
           
               
               
           
         
         wherein “20-nt targeting seq” is nnnnnnnnnnnnnnnnnnnn. 
       
     
     
         4 . A method of cleaving a target DNA, the method comprising:
 contacting a target DNA with:   (a) the composition of claim  242  comprising the single molecule DNA-targeting RNA, wherein the nucleotide sequence of the single-molecule DNA-targeting RNA is GAUUUCUUCUUGCGCUUUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 321); and   (b) a Cas9 protein comprising the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2,   wherein said contacting does not take place inside of a cell, and   wherein the target DNA is cleaved.