US2021348205A1PendingUtilityA1

Expression System

71
Assignee: FUJIFILM DIOSYNTH BIOTECHNOLOGIES UK LTDPriority: Feb 3, 2006Filed: Jul 16, 2021Published: Nov 11, 2021
Est. expiryFeb 3, 2026(expired)· nominal 20-yr term from priority
Inventors:Bhupendra Vallabh KaraChristopher David John LennonIan John Hodgson
C12P 21/00C12N 15/70C12N 15/73C12N 15/09C12N 15/78C12N 15/85C12R 2001/19C12N 15/72C12N 1/205C12N 15/81
71
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A perfect palindrome operator sequence-based protein expression system is provided. The expression system comprises a promoter; and a perfect palindrome operator sequence, wherein the promoter is not T7. The expression system is preferably employed for the production of recombinant proteins by fermentation.

Claims

exact text as granted — not AI-modified
1 - 16 . (canceled) 
     
     
         17 . A perfect palindrome operator sequence-based recombinant protein expression system for expression of proteins in  E. coli  cells comprising an  E. coli  host cell comprising an expression cassette comprising:
 (a) a T7A3 promoter;   (b) a single operator sequence, said operator sequence being a perfect palindrome operator sequence, wherein the operator sequence is located downstream of the promoter; and   a sequence encoding a protein.   
     
     
         18 . An expression system according to  claim 17 , wherein the perfect palindrome operator sequence overlaps the transcriptional start point. 
     
     
         19 . A method according to  claim 17 , wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3). 
     
     
         20 . An  E. coli  host cell transformed with a plasmid, said plasmid comprising an expression cassette comprising:
 (a) a T7A3 promoter;   (b) a single operator sequence, said operator sequence being a perfect palindrome operator sequence, wherein the operator sequence is located downstream of the promoter; and   (c) a sequence encoding a protein.   
     
     
         21 . An  E. coli  host cell according to  claim 20 , wherein the perfect palindrome operator sequence overlaps the transcriptional start point. 
     
     
         22 . An  E. coli  host cell according to  claim 20 , wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3). 
     
     
         23 . A method for the production of a recombinant protein in an  E. coli  host cell which comprises the step of expressing the expression system according to  claim 17  in the  E. coli  host cell. 
     
     
         24 . A method according to  claim 23 , wherein the perfect palindrome operator sequence overlaps the transcriptional start point. 
     
     
         25 . A method for producing a protein, which comprises:
 (a) culturing an  E. coli  host cell according to  claim 20 ; and   (b) recovering the protein.   
     
     
         26 . A method according to  claim 25 , wherein the perfect palindrome operator sequence overlaps the transcriptional start point. 
     
     
         27 . A method according to  claim 26 , wherein the perfect palindrome operator sequence is a lac operator sequence. 
     
     
         28 . A method according to  claim 27 , wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3). 
     
     
         29 . A method according to  claim 18 , wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3). 
     
     
         30 . An  E. coli  host cell according to  claim 21 , wherein the perfect palindrome operator sequence has the nucleic acid sequence GGAATTGTGAGCGCTCACAATTCC (nucleotides 51-74 of SEQ ID NO: 3).

Join the waitlist — get patent alerts

Track US2021348205A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.