US2021308261A1PendingUtilityA1
Egfr-directed car therapy for glioblastoma
Est. expiryApr 6, 2035(~8.7 yrs left)· nominal 20-yr term from priority
C07K 14/7051A61K 40/31A61K 40/4204A61K 40/15C12N 5/0646C12N 5/0636A61K 2039/5156A61K 2039/5158A61K 2039/80C07K 2319/33A61P 35/00A61K 39/395A61K 39/001104A61K 35/17C07K 16/2863C12N 2740/15043C07K 2319/03C07K 2317/622C12N 15/86C07K 16/30C07K 14/70521
59
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
Glioblastoma (GB) remains the most aggressive primary brain malignancy; brain metastasis, such as breast cancer brain metastases (BCBMs), are also aggressive and are associated with poor prognosis. Adoptive transfer of chimeric antigen receptor (CAR)-modified immune cells has emerged as a promising anti-cancer approach, yet the potential utility of CAR-engineered cells to treat brain cancers has not been explored. The present disclosure presents compostions and methods for using CAR expressing cells in the treatment of various cancers, including brain cancers such as GB and BCBMs.
Claims
exact text as granted — not AI-modified1 . (canceled)
2 . The method of claim 63 , wherein the costimulatory molecule comprises a molecule or polypeptide selected from the group of: a 4-1BB costimulatory signaling region, a CD28 costimulatory molecule, OX40, ICOS, CD27, CD30, CD40, PD-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, or a ligand that specifically binds with CD83.
3 . The method of claim 63 , wherein the antigen binding domain of the anti-EGFR antibody comprises an anti-EGFR heavy chain (HC) variable region comprising the amino acid sequence of SEO ID NO: 24 or an equivalent thereof having at least 80% identity to SEO ID NO: 24 and an anti-EGFR light chain (LC) variable region comprising the amino acid sequence of SEO ID NO: 26 or an equivalent thereof having at least 80% identity to SEO ID NO: 26.
4 - 5 . (canceled)
6 . The method of claim 3 , further comprising a linker polypeptide located between the anti-EGFR HC variable region and the anti-EGFR LC variable region.
7 . The method of claim 6 , wherein the linker polypeptide comprises GGGGSGGGGSGGGG, or an equivalent thereof.
8 . The method of claim 63 , further comprising a signal polypeptide to the amino terminus of the EGFR binding domain.
9 . The method of claim 63 , wherein the hinge polypeptide comprises CTCGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCG, or an equivalent thereof.
10 . The method of claim 2 , wherein the CD28 costimulatory molecule comprises a CD28 transmembrane domain and a CD28 intracellular domain, or an equivalent of each thereof.
11 . The method of claim 63 , further comprising a detectable marker and/or a purification marker attached to the CAR.
12 .- 40 . (canceled)
41 . The method of claim 3 , wherein the cell is a cell of the group consisting of a mammalian cell, a canine cell, a bovine cell, a murine cell, a feline cell, an equine cell or a human cell, and optionally a stem cell, a macrophage, a T cell or an NK cell.
42 .- 50 . (canceled)
51 . The method of claim 63 , wherein the isolated cells are autologous to the subject being treated.
52 . The method of claim 63 , wherein the cells are administered by intracranial injection or intravenous administration.
53 . The method of claim 63 , wherein the subject is selected from the group of a mammal, a murine, a canine, a bovine, a murine, a feline, an equine or a human.
54 .- 57 . (canceled)
58 . The method of claim 63 , further comprising administering an effective amount of anti-cancer therapy.
59 . The method of claim 58 , wherein the anti-cancer therapy comprises one or more of radiation therapy, surgery or chemotherapy.
60 .- 62 . (canceled)
63 . A method for treating a cancer in a subject in need thereof, comprising administering to the subject:
an effective amount of isolated cells expressing a chimeric antigen receptor (CAR) comprising (a) an antigen binding domain of an anti-Epidermal Growth Factor Receptor (anti-EGFR) antibody that recognizes both wild type Epidermal Growth Factor Receptor (wtEGFR) and Epidermal Growth Factor Receptor variant III mutant (EGFRvIII), wherein the antigen binding domain comprises the three complementarity determining regions (CDRs) of an anti-EGFR heavy chain (HC) variable region of SEO ID NO: 24; and the three CDRs of an anti-EGFR light chain (LC) variable region of SEO ID NO: 26: (b) a hinge domain polypeptide; (c) a costimulatory molecule or polypeptide; and (d) a CD3 zeta signaling domain; and an effective amount of an oncolytic virus.
64 . The method of claim 63 , wherein the isolated cell is an NK cell.
65 . The method of claim 63 , wherein the isolated cells have been irradiated.
66 . The method of claim 65 , wherein the isolated cells have been irradiated at a dose of 1000 cGy.
67 . The method of claim 75 , wherein the oncolytic herpes simplex virus is or is derived from an HSV-1.
68 . The method of claim 63 , wherein the effective amount of the isolated cells is administered before the effective amount of the oncolytic virus.
69 . The method of claim 68 , wherein the effective amount of oncolytic virus is administered over multiple days.
70 . The method of claim 63 , wherein the cancer is a brain cancer.
71 . The method of claim 70 , wherein the brain cancer is selected from a glioblastoma or a breast cancer brain metastasis.
72 . (canceled)
73 . The method of claim 63 , wherein the effective amount of the isolated cells is administered after the effective amount of the oncolytic virus.
74 . The method of claim 63 , wherein the effective amount of the isolated cells is administered simultaneously with the effective amount of the oncolytic virus.
75 . The method of claim 63 , wherein the oncolytic virus is an oncolytic herpes simplex virus.
76 . A therapeutic combination comprising:
an isolated cell expressing a chimeric antigen receptor (CAR) comprising (a) an antigen binding domain of an anti-Epidermal Growth Factor Receptor (anti-EGFR) antibody that recognizes both wild type Epidermal Growth Factor Receptor (wtEGFR) and Epidermal Growth Factor Receptor variant III mutant (EGFRvIII), wherein the antigen binding domain comprises the three complementarity determining regions (CDRs) of an anti-EGFR heavy chain (HC) variable region of SEQ ID NO: 24 and the three CDRs of an anti-EGFR light chain (LC) variable region of SEQ ID NO: 26; (b) a hinge domain polypeptide; (c) a costimulatory molecule or polypeptide; and (d) a CD3 zeta signaling domain; and an oncolytic virus.
77 . The therapeutic combination of claim 76 , wherein the costimulatory molecule comprises a molecule or polypeptide selected from the group of: a 4-1BB costimulatory signaling region, a CD28 costimulatory molecule, OX40, ICOS and CD27.
78 . The therapeutic combination of claim 76 , wherein the antigen binding domain of the anti-EGFR antibody comprises an anti-EGFR heavy chain (HC) variable region comprising the amino acid sequence of SEQ ID NO: 24 or an equivalent thereof having at least 80% identity to SEQ ID NO: 24; and an anti-EGFR light chain (LC) variable region comprising the amino acid sequence of SEQ ID NO: 26 or an equivalent thereof having at least 80% identity to SEQ ID NO: 26.
79 . The therapeutic combination of claim 77 , wherein the CD28 costimulatory molecule comprises a CD28 transmembrane domain and a CD28 intracellular domain.
80 . The therapeutic combination of claim 76 , wherein the oncolytic virus is an oncolytic herpes simplex virus.
81 . The therapeutic combination of claim 80 , wherein the oncolytic herpes simplex virus is or is derived from an HSV-1.
82 . The therapeutic combination of claim 76 , wherein the isolated cell is an NK cell.
83 . The therapeutic combination of claim 76 , wherein the therapeutic combination is formulated to treat a brain cancer.
84 . The therapeutic combination of claim 83 , wherein the brain cancer is selected from a glioblastoma or a breast cancer brain metastasis.
85 . The therapeutic combination of claim 76 , wherein the isolated cell is formulated for intracranial injection or intravenous administration.Join the waitlist — get patent alerts
Track US2021308261A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.