US2021207130A1PendingUtilityA1

Methods and compositions for the making and using of guide nucleic acids

Assignee: ARC BIO LLCPriority: Dec 7, 2015Filed: Aug 17, 2020Published: Jul 8, 2021
Est. expiryDec 7, 2035(~9.4 yrs left)· nominal 20-yr term from priority
C40B 40/06A61K 48/00C12N 15/62C12N 15/1068C12N 15/113C12N 15/111C12N 15/115C12N 2320/10C12N 2750/14143C12N 15/63C12N 2800/70C12N 2310/20C12N 9/22C12N 9/222
54
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Provided herein are methods and compositions to make guide nucleic acids (gNAs), nucleic acids encoding gNAs, collections of gNAs, and nucleic acids encoding for a collection of gNAs from any source nucleic acid. Also provided herein are methods and compositions to use the resulting gNAs, nucleic acids encoding gNAs, collections of gNAs, and nucleic acids encoding for a collection of gNAs in a variety of applications.

Claims

exact text as granted — not AI-modified
1 . A collection of nucleic acids the nucleic acids in the collection comprising:
 a second segment encoding a targeting sequence; and   a third segment encoding a nucleic acid-guided nuclease system protein-binding sequence, wherein the collection of nucleic acids comprises at least 10 5  unique nucleic acid molecules.   
     
     
         2 . The collection of  claim 1 , wherein the nucleic acid-guided nuclease system protein is a CRISPR/Cas system protein. 
     
     
         3 . The collection of  claim 1 , wherein the size of the second segment varies from 15-250 bp across the collection of nucleic acids. 
     
     
         4 . The collection of  claim 1 , wherein at least 10% of the second segments in the collection are greater than 21 bp. 
     
     
         5 . The collection of  claim 1 , wherein the size of the second segment is not 20 bp and is not 21 bp. 
     
     
         6 . (canceled) 
     
     
         7 . The collection of  claim 1 , wherein the collection of nucleic acids is a collection of DNA. 
     
     
         8 . The collection of  claim 7 , wherein the second segment is single stranded DNA. 
     
     
         9 . The collection of  claim 7 , wherein the third segment is single stranded DNA. 
     
     
         10 . The collection of  claim 7 , wherein the third segment is double stranded DNA. 
     
     
         11 . The collection of  claim 1 , further comprising a first segment comprising a regulatory region, wherein the regulatory region is a region capable of binding a transcription factor. 
     
     
         12 . The collection of  claim 1 , further comprising a first segment comprising a regulatory region, wherein the regulatory region comprises a promoter. 
     
     
         13 . The collection of  claim 13 , wherein the promoter is selected from the group consisting of T7, SP6, and T3. 
     
     
         14 . The collection of  claim 1 , wherein the targeting sequence is directed at a mammalian genome, eukaryotic genome, prokaryotic genome, or a viral genome. 
     
     
         15 . The collection of  claim 1 , wherein the targeting sequence is directed at repetitive or abundant DNA. 
     
     
         16 . The collection of  claim 1 , wherein the targeting sequence is directed at mitochondrial DNA, ribosomal DNA, Alu DNA, centromeric DNA, SINE DNA, LINE DNA, or STR DNA. 
     
     
         17 . The collection of  claim 1 , wherein the sequence of the second segments is selected from Table 3 and/or Table 4. 
     
     
         18 . (canceled) 
     
     
         19 . The collection of  claim 1 , wherein the targeting sequence is at least 80% complementary to the strand opposite to a sequence of nucleotides 5′ to a PAM sequence. 
     
     
         20 . The collection of  claim 1 , wherein the collection comprises targeting sequences directed to sequences of interest spaced about every 10,000 bp or less across the genome of an organism. 
     
     
         21 . The collection of  claim 20 , wherein the PAM sequence is AGG, CGG, or TGG. 
     
     
         22 . The collection of  claim 20 , wherein the PAM sequence is specific for a CRISPR/Cas system protein selected from the group consisting of Cas9, Cpf1, Cas3, Cas8a-c, Cas10, Cse1, Csy1, Csn2, Cas4, Csm2, and Cm5. 
     
     
         23 . The collection of  claim 1 , wherein the third segment comprises DNA encoding a gRNA stem-loop sequence. 
     
     
         24 . The collection of  claim 1 , wherein the sequence of the third segment encodes for a RNA comprising the sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAA AGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 1) or encodes for a RNA comprising the sequence GUUUUAGAGCUAUGCUGGAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUC AACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUC (SEQ ID NO: 2). 
     
     
         25 . The collection of  claim 1 , wherein the sequence of the third segment encodes for a crRNA and a tracrRNA. 
     
     
         26 . The collection of  claim 1 , wherein the nucleic acid-guided nuclease system protein is from a bacterial species. 
     
     
         27 . The collection of  claim 1 , wherein the nucleic acid-guided nuclease system protein is from an archaea species. 
     
     
         28 . The collection of  claim 2 , wherein the CRISPR/Cas system protein is a Type I, Type II, or Type III protein. 
     
     
         29 . The collection of  claim 2 , wherein the CRISPR/Cas system protein is selected from the group consisting of Cas9, Cpf1, Cas3, Cas8a-c, Cas10, Cse1, Csy1, Csn2, Cas4, Csm2, Cm5, dCas9 and cas9 nickase. 
     
     
         30 . The collection of  claim 1 , wherein the third segment comprises DNA encoding a Cas9-binding sequence. 
     
     
         31 . The collection of  claim 1 , wherein a plurality of third segments of the collection encode for a first nucleic acid-guided nuclease system protein binding sequence, and a plurality of the third segments of the collection encode for a second nucleic acid-guided nuclease system protein binding sequence. 
     
     
         32 . The collection of  claim 1 , wherein the third segments of the collection encode for a plurality of different binding sequences of a plurality of different nucleic acid-guided nuclease system proteins. 
     
     
         33 .- 192 . (canceled) 
     
     
         193 . A kit comprising the collection of nucleic acids of  claim 1 . 
     
     
         194 .- 235 . (canceled) 
     
     
         236 . The collection of  claim 1 , wherein at least 10% of the nucleic acids in the collection vary in size. 
     
     
         237 . The collection of  claim 1 , further comprising a first segment comprising a regulatory region. 
     
     
         238 . A collection of guide RNAs generated by transcribing the collection of  claim 1 .

Join the waitlist — get patent alerts

Track US2021207130A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.