Gene osnia3 of rice nitrate reductase nia3 protein, and its application

Abstract

The present invention discloses a gene OsNia3 of a rice nitrate reductase NIA3 protein. The cDNA sequence of the gene is as set out in SEQ ID NO.1, and the rice NIA3 protein encoded by it has an amino acid sequence as set out in SEQ ID NO.2. A homozygous mutant in which the rice gene OsNia3 is knocked out and a homozygous line in which the OsNia3 is over-expressed are obtained by utilizing a transgenic technology. It has been discovered by analysis that the line in which the OsNia3 gene is knocked out has a shortened plant height and a shorted growth period; while the line in which the OsNia3 is over-expressed has a relatively high plant height and a prolonged growth period.

1 - 10 . (canceled) 
     
     
         11 . A rice gene OsNia3 knockout vector pCas9-OsNia3 obtained by connecting an 18 bp sequence of the gene OsNia3 of a rice nitrate reductase NIA3 protein to a vector pCas9. 
     
     
         12 . A rice gene OsNia3 expression vector pCUBi1390-GFP-OsNia3 obtained by cloning a cDNA sequence of a rice gene OsNia3 as set out in SEQ ID NO. 1 into enzyme cleavage sites Hand III and BamH I in a binary expression vector pCUBi1390-GFP. 
     
     
         13 . A method of producing a transgenic rice plant, comprising:
 transferring a rice gene OsNia3 knockout vector pCas9-OsNia3 into  Agrobacterium tumefaciens ; and   transferring the  Agrobacterium tumefaciens  into a japonica rice variety Kitaake to obtain a homozygous knockout mutant nia3 having mutation of the OsNia3 gene and no backbone of the knockout vector.   
     
     
         14 . The method of producing a transgenic rice plant of  claim 13 , further comprising:
 producing the rice gene OsNia3 knockout vector, by:   designing a primer fragment according to a full-length cDNA sequence of the rice gene OsNia3 as set out in SEQ ID NO. 1 using a CRISPR-P online website, P1 having SEQ ID NO.3 and P2 having SEQ ID NO.4 for two terminals;   pasting the sequence of the designed primer fragment and a partial sequence of a sgRNA backbone on a vector pCas9 into an RNA fold Web server for RNA structure prediction, such that a primer fragment P3: SEQ ID NO.5 is obtained;   adding a linker sequence onto the primer fragment P3: SEQ ID NO.5 to obtain a primer fragment P4: SEQ ID NO.6 and its reverse complementary sequence P5: SEQ ID NO.7:   synthesizing the primer fragment P4 and its reverse complementary sequence P5;   annealing the obtained primer fragment P4 and its reverse complementary sequence P5 with a PCR amplifier to obtain an annealed product; and   cloning the annealed product into the vector pCas9.   
     
     
         15 . The method of producing a transgenic rice plant of  claim 14 , wherein the primers for two terminals have the sequences 
       
         
           
                 
                 
               
                     
                   SEQ ID NO. 3: 
                 
                     
                   5-TGAACGCAGAACCGAACAC-3; 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   SEO ID NO. 4: 
                 
                     
                   5-TCCACGGGCCACCATAC-3. 
                 
             
                
                
                
                
                
                
               
            
           
         
       
     
     
         16 . The method of producing a transgenic rice plant of  claim 14 , wherein the primer fragments have the sequences 
       
         
           
                 
               
                   SEQ ID NO. 5: 
                 
                   5-GCTCGGGGAACCGCCGCA-3; 
                 
                     
                 
                   SEQ ID NO. 6: 
                 
                   5-GCTCGGGGAACCGCCGCAGTTTTAGAGCTATGCTGAAAAGCATAG 
                 
                     
                 
                   CAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG 
                 
                     
                 
                   AGTCGGTGC-3; 
                 
                   and 
                 
                     
                 
                   SEQ ID NO. 7: 
                 
                   5-GCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTT 
                 
                     
                 
                   ATTTTAACTTGCTATGCTTTTCAGCATAGCTCTAAAACTGCGGCGGTTC 
                 
                     
                 
                   CCCGAGC-3. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         17 . The method of producing a transgenic rice plant of  claim 13 , further comprising:
 transferring an expression vector for a rice gene OsNia3 pCUBi1390-GFP-OsNia3 into  Agrobacterium tumefaciens ; and   transferring the  Agrobacterium tumefaciens  into the homozygous knockout mutant nia3.   
     
     
         18 . The method of producing a transgenic rice plant of  claim 17 , further comprising:
 producing the expression vector for the rice gene OsNia3 pCUBi1390-GFP-OsNia3, by:   designing an upstream primer P6: SEQ ID NO.8 and a downstream primer P7: SEQ ID NO.9 which carry restriction enzyme cleavage sites Hand III and BamH I that are completely encoded at the amplification position;   amplifying an over-expression vector pCUbi1390-GFP-Nia3 by PCR; and   cloning cDNA of the rice gene OsNia3 to the enzyme cleavage sites Hand III and BamH I in a binary expression vector pCUBi1390-GFP.   
     
     
         19 . The method of producing a transgenic rice plant of  claim 18 , further comprising:
 producing the over-expression vector pCUbi1390-GFP-Nia3, by:   extracting total RNA of rice leaves;   designing primers P1 having SEQ ID NO.3 and P2 having SEQ ID NO.4 for two terminals according to a full-length sequence of the rice gene OsNia3;   transcribing the total RNA of rice leaves to synthesize a first chain of cDNA;   amplifying the first chain of the cDNA by PCR;   extracting the cDNA using a TaKaRa MiniBEST Agarose Gel DNA Extraction Kit; and   ligating the cDNA with an over-expression vector pCUbi1390-GFP.   
     
     
         20 . The method of producing a transgenic rice plant of  claim 19 , wherein the primers for two terminals have the sequences 
       
         
           
                 
                 
               
                     
                   SEQ ID NO. 3: 
                 
                     
                   5-TGAACGCAGAACCGAACAC-3; 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   SEQ ID NO. 4: 
                 
                     
                   5-TCCACGGGCCACCATAC-3. 
                 
             
                
                
                
                
                
                
               
            
           
         
       
     
     
         21 . The method of producing a transgenic rice plant of  claim 18 , wherein the upstream and downstream primers have the sequences 
       
         
           
                 
               
                   SEQ ID NO. 8: 
                 
                   5-TCTGCACTAGGTACCTGCAGATGGCTGCTTCCGTGC-3; 
                 
                   and 
                 
                     
                 
                   SEQ ID NO. 9: 
                 
                   5-ATGGATCCGTCGACCTGCAGGAACACGATGAAAGAATTGGCC-3.