Citrus greening (huanglongbing-induced small rnas are potential early diagnosis markers

Abstract

The present invention provides compositions and methods for detecting Candidatus liberibacter infection and Huanglongbing disease in a citrus plant by detecting the expression of small RNAs such as miRNA and siRNA. The invention also provides methods for treating Huanglongbing disease in a citrus plant by contacting the plant with a phosphorus containing solution.

What is claimed is: 
     
         1 . A method for detection of Huanglongbing (HLB) disease or  Ca. l. asiaticus -infection in a citrus plant, comprising detecting in a sample from the citrus plant the level of expression of one or more RNA selected from the group consisting of miRNA399, siRNA1005, siRNA1008 and siRNA1009, wherein increased expression of the one or more RNA compared to expression of the RNA in a non-infected healthy plant indicates the presence of  Ca. l. asiaticus  infection. 
     
     
         2 . The method of  claim 1 , wherein the miRNA399 sequence comprises TG X 1  X 2  AAAGGAG X 3  X 4  TTGCC X 5  X 6  X 7  (SEQ ID NO:99), where X 1  is C or T, X 2  is C or T, X 3  is A or C, X 4  is G, T, or A, X 5  is C or A, X 6  is T or G, and X 7  is A or G. 
     
     
         3 . The method of  claim 1 , wherein the miRNA399 comprises a sequence at least 90% identical to UGCCAAAGGAGAUUUGCCCGG (SEQ ID NO:9), UGCCAAAGGAGAGUUGCCCUA (SEQ ID NO:10), UGCCAAAGGAGAAUUGCCCUG (SEQ ID NO:11), and UGCCAAAGGAGAGUUGCCCUG (SEQ ID NO:12);
 the siRNA1005 comprises a sequence at least 90% identical to ATAGATAATGGATCAACGGTTATA (SEQ ID NO:13);   the siRNA1008 comprises a sequence at least 90% identical to TCGAACAAGGTAAGGATGTCA (SEQ ID NO:14) or CCTTGTTCGAACAAGGTAAGGATGTCATTCTTT (SEQ ID NO:100); and   the siRNA1009 comprises a sequence at least 90% identical to CTTCTAATAAACATGCATGAA (SEQ ID NO:15) or CGTCTTCTAATAAACATGCATGAACTTATT (SEQ ID NO:101).   
     
     
         4 . The method of  claim 1 , wherein the method further comprises detecting the mRNA of a ubiquitin-conjugating enzyme E2 (UBC) gene. 
     
     
         5 . The method of  claim 4 , wherein the UBC mRNA comprises a sequence that is at least 90% identical to SEQ ID NO:84. 
     
     
         6 . The method of  claim 1 , wherein the method further comprises measuring phosphate levels in the plant. 
     
     
         7 . The method of  claim 1 , further comprising contacting the plant with phosphate or a phosphorus oxyanion if the plant is infected with  Ca. l.    
     
     
         8 . A method of treating HLB disease comprising contacting a plant infected with HLB disease or having  Ca. l. asiaticus -infection with phosphorus oxyanions, stimulating phosphate uptake in the plant by suppressing UBC mRNA or UBC polypeptide and inducing phosphorus transporters in the plant, thereby ameliorating symptoms of HLB disease in the plant. 
     
     
         9 . The method of  claim 8 , further comprising contacting the plant with phosphorus oxyanion solutions in sufficient amount to ameliorate symptoms of HLB disease in the plant. 
     
     
         10 . A kit for detection of Huanglongbing (HLB) disease or  Ca. l. asiaticus  infection, the kit comprising:
 one or more agents that specifically detects miRNA399, siRNA1005, siRNA1008 or siRNA1009.   
     
     
         11 . The kit of  claim 10 , wherein:
 the miRNA399 comprises a sequence at least 90% identical to UGCCAAAGGAGAUUUGCCCGG (SEQ ID NO:9), UGCCAAAGGAGAGUUGCCCUA (SEQ ID NO:10), UGCCAAAGGAGAAUUGCCCUG (SEQ ID NO:11), and UGCCAAAGGAGAGUUGCCCUG (SEQ ID NO:12);   the siRNA1005 comprises a sequence at least 90% identical to ATAGATAATGGATCAACGGTTATA (SEQ ID NO:13);   the siRNA1008 comprises a sequence at least 90% identical to TCGAACAAGGTAAGGATGTCA (SEQ ID NO:14) or CCTTGTTCGAACAAGGTAAGGATGTCATTCTTT (SEQ ID NO:100); and   the siRNA1009 comprises a sequence at least 90% identical to CTTCTAATAAACATGCATGAA (SEQ ID NO:15) or CGTCTTCTAATAAACATGCATGAACTTATT (SEQ ID NO:101).   
     
     
         12 . The kit of  claim 10 , further comprising oligonucleotide primers comprising a sequence selected from the group consisting of SEQ ID NOs:85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, and 96. 
     
     
         13 . The kit of  claim 10 , wherein the agent is a locked nucleic acid (LNA) probe. 
     
     
         14 . The kit of  claim 10 , wherein the agent is a probe is labeled with a detectable label. 
     
     
         15 . The kit of  claim 10 , further comprising inorganic phosphite and/or phosphate (Pi). 
     
     
         16 . The kit of  claim 10 , further comprising an expression cassette comprising a promoter operably linked to a polynucleotide encoding miRNA399, siRNA1005, siRNA1008 or siRNA1009.