US2020399641A1PendingUtilityA1

Antisense oligonucleotides for modulating htra1 expression

Assignee: HOFFMANN LA ROCHEPriority: Jul 1, 2016Filed: Dec 30, 2019Published: Dec 24, 2020

Est. expiryJul 1, 2036(~9.9 yrs left)· nominal 20-yr term from priority

Inventors:Roberto Iacone Peter Hagedorn Susanne Kammler Soren Ottosen Sindri Traustason Heidi Rye Hudlebusch Lykke Pedersen

C12N 2310/3231C12N 2310/3341C12N 2310/346C12N 2310/315C12N 2310/11C12N 2310/341C12N 2310/351C12N 2310/344C12Y 304/21A61P 21/00A61P 9/10A61P 25/28A61P 25/16A61P 25/00A61P 27/02A61P 19/02A61K 31/7088C12N 15/1137A61P 43/00

PatentIndex Score

Cited by

References

Claims

Abstract

The present invention relates to antisense oligonucleotides (oligomers) that are complementary to HTRA1, leading to modulation of the expression of HTRA1. Modulation of HTRA1 expression is beneficial for a range of medical disorders, such as macular degeneration, e.g. age-related macular degeneration.

Claims

exact text as granted — not AI-modified

1 . An antisense oligonucleotide of 10-30 nucleotides in length, wherein said antisense oligonucleotide targets a HTRA1 nucleic acid and comprises a contiguous nucleotide region of 10-22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 147: 
       
         
           
                 
                 
               
                     
                   SEQ ID NO 147: 5′ CCAACAACCAGGTAAATATTTG 3′

Join the waitlist — get patent alerts

Track US2020399641A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.