OLIGONUCLEOTIDE-BASED MODULATION OF C9orf72

Abstract

This disclosure relates to novel C9ORF72 targeting sequences. Novel oligonucleotides for the treatment of neurodegenerative diseases are also provided.

1 . An RNA molecule comprising between 15 and 35 bases in length, comprising a region of complementarity, which is substantially complementary to: (i) 5′ AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3′ (SEQ ID NO: 1), or (ii) a portion of 5′ AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3′ (SEQ ID NO: 1) (having a length of from 10 to 30 contiguous nucleotides. 
     
     
         2 . The RNA molecule of  claim 1 , comprising a region of complementarity, which is substantially complementary to AUAAAGAUUAACCAGAAGAA (SEQ ID NO: 2). 
     
     
         3 . The RNA molecule of  claim 1 , wherein said RNA molecule is single stranded (ss) RNA or double stranded (ds) RNA, wherein the dsRNA optionally comprises one or more of the following:
 a sense strand and an antisense strand, wherein the antisense strand comprises the region of complementarity which is optionally: substantially complementary to SEQ ID NO: 1; complementary to at least 10, 11, 12 or 13 contiguous nucleotides of SEQ ID NO: 1; contains no more than 3 mismatches with SEQ ID NO: 1; or fully complementary to SEQ ID NO: 1;   is between 15 and 25 basepairs in length;   is blunt-ended;   comprises at least one single stranded nucleotide overhang;   comprises naturally occurring nucleotides;   comprises at least one modified nucleotide optionally chosen from the group consisting of a 2′-O-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide;   is at least 80% chemically modified or is fully chemically modified; or   comprises a cholesterol moiety.   
     
     
         4 - 19 . (canceled) 
     
     
         20 . The dsRNA of  claim 3 , said dsRNA having a 5′ end, a 3′ end and complementarity to a target, and comprising a first oligonucleotide and a second oligonucleotide, wherein:
 (1) the first oligonucleotide comprises a sequence substantially complementary to SEQ ID NO: 1, 
 (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; 
 (3) the second oligonucleotide comprises alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides or the second oligonucleotide comprises a region of three contiguous 2′-methoxy-ribonucleotides; 
 (4) the nucleotides at positions 2 and 14 from the 3′ end of the second oligonucleotide are 2′-methoxy-ribonucleotides; and 
 (5) the nucleotides of the second oligonucleotide are connected via phosphodiester or phosphorothioate linkages, optionally wherein: 
 the nucleotides at positions 1 and 2 from one or both of the 5′ end and 3′ end of second oligonucleotide are connected to adjacent nucleotides via phosphorothioate linkages; or 
 the second oligonucleotide is linked to a hydrophobic molecule at the 3′ end of the second oligonucleotide, wherein the linkage between the second oligonucleotide and the hydrophobic molecule optionally comprises polyethylene glycol or triethylene glycol. 
 
     
     
         21 - 26 . (canceled) 
     
     
         27 . A pharmaceutical composition for inhibiting expression of C9ORF72 gene in an organism, comprising the dsRNA of  claim 3  and a pharmaceutically acceptable carrier, optionally wherein the dsRNA inhibits the expression of said C9ORF72 gene by at least 50% or by at least 90%. 
     
     
         28 - 29 . (canceled) 
     
     
         30 . A method for inhibiting expression of C9ORF72 gene in a cell, the method comprising:
 (a) introducing into the cell a double-stranded ribonucleic acid (dsRNA) of  claim 3 ; and   (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the C9ORF72 gene, thereby inhibiting expression of the C9ORF72 gene in the cell.   
     
     
         31 . A method of treating or managing a neurodegenerative disease comprising administering to a patient in need of such treatment or management a therapeutically effective amount of said dsRNA of  claim 3 , optionally wherein:
 said dsRNA is administered to the brain of the patient;   said dsRNA is administered by intracerebroventricular (ICV) or intrathecal (IT) injection;   administering the dsRNA causes a decrease in C9ORF72 gene mRNA in the brain;   administering the dsRNA causes a decrease in C9ORF72 gene mRNA in the spinal cord; or   the dsRNA inhibits the expression of said C9ORF72 gene by at least 50% or at least 90%.   
     
     
         32 - 37 . (canceled) 
     
     
         38 . A vector for inhibiting the expression of C9ORF72 gene in a cell, said vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes an RNA molecule substantially complementary to 5′ AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3′, wherein said RNA molecule is between 10 and 35 bases in length, and wherein said RNA molecule, upon contact with a cell expressing said C9ORF72 gene, inhibits the expression of said C9ORF72 gene by at least 50%. 
     
     
         39 . (canceled) 
     
     
         40 . The vector of  claim 38 , wherein said RNA molecule is ssRNA or dsRNA, wherein the dsRNA optionally comprises a sense strand and an antisense strand, and wherein the antisense strand comprises the region of complementarity which is substantially complementary to SEQ ID NO: 1. 
     
     
         41 . (canceled) 
     
     
         42 . A cell comprising the vector of  claim 38 . 
     
     
         43 - 45 . (canceled) 
     
     
         46 . A di-branched RNA compound comprising two RNA molecules that are between 15 and 35 bases in length, comprising a region of complementarity which is substantially complementary to C9ORF72 mRNA, wherein the two RNA molecules are connected to one another by one or more moieties independently selected from a linker, a spacer and a branching point. 
     
     
         47 . The RNA molecule of  claim 46 , comprising a region of complementarity which is substantially complementary to SEQ ID NO: 1, optionally wherein:
 the RNA molecule comprises a region of complementarity, which is substantially complementary to SEQ ID NO: 2;   the RNA molecule comprises ssRNA or dsRNA, and/or   the RNA molecule comprises an antisense molecule or a GAPMER molecule, wherein the antisense molecule:
 comprises an antisense oligonucleotide; and/or 
 enhances degradation of the region of complementarity, optionally wherein the degradation comprises nuclease degradation, optionally wherein the nuclease degradation is mediated by RNase H. 
   
     
     
         48 - 54 . (canceled) 
     
     
         55 . An RNA molecule comprising between 15 and 35 bases in length, comprising a region of complementarity which is substantially complementary to a gene region in the C9ORF72 gene as recited in Table 1, Table 2, Table 3, Table 4, or Table 5. 
     
     
         56 - 71 . (canceled) 
     
     
         72 . A compound of formula (I):
   L-(N) n   (I)
   wherein:   L is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a peptide, an RNA, a DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof, optionally wherein formula (I) further comprises one or more branch point B, and one or more spacer S, wherein:   B is independently for each occurrence a polyvalent organic species or a derivative thereof;   S is independently for each occurrence selected from the group consisting of an ethylene glycol chain, an alkyl chain, a peptide, an RNA, a DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof;   N is a double stranded nucleic acid between 15 and 35 bases in length comprising a sense strand and an antisense strand, wherein:   the antisense strand comprises a region of complementarity, which is substantially complementary to 5′ AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3′;   the sense strand and antisense strand each independently comprise one or more chemical modifications; and   n is 2, 3, 4, 5, 6, 7 or 8.   
     
     
         73 . The compound of  claim 72 , having a structure selected from formulas (I-1)-(I-9): 
       
         
           
           
               
               
           
         
       
       optionally wherein:
 the antisense strand comprises a 5′ terminal group R selected from the group consisting of: 
 
       
         
           
           
               
               
           
         
         
           
           
               
               
           
         
       
       and/or
 wherein L is of structure L1: 
 
       
         
           
           
               
               
           
         
       
       optionally wherein R is R 3  and n is 2; or
 wherein L is of structure L2: 
 
       
         
           
           
               
               
           
         
       
       optionally wherein R is R 3  and n is 2. 
     
     
         74 . (canceled) 
     
     
         75 . The compound of  claim 72 ,
 having the structure of formula (II):   
       
         
           
           
               
               
           
         
       
       wherein:
 X, for each occurrence, independently, is selected from the group consisting of adenosine, guanosine, uridine, cytidine, and chemically-modified derivatives thereof; 
 Y, for each occurrence, independently, is selected from the group consisting of adenosine, guanosine, uridine, cytidine, and chemically-modified derivatives thereof; 
 - represents a phosphodiester internucleoside linkage; 
 =represents a phosphorothioate internucleoside linkage; --- represents, individually for each occurrence, a base-pairing interaction or a mismatch, or 
 having the structure of formula (III): 
 
       
         
           
           
               
               
           
         
         wherein: 
         X for each occurrence, independently, is a nucleotide comprising a 2′-deoxy-2′-fluoro modification; 
         X, for each occurrence, independently, is a nucleotide comprising a 2′-O-methyl modification; 
         Y for each occurrence, independently, is a nucleotide comprising a 2′-deoxy-2′-fluoro modification; 
         Y, for each occurrence, independently, is a nucleotide comprising a 2′-O-methyl modification; or 
         having the structure of formula (IV): 
       
       
         
           
           
               
               
           
         
         wherein: 
         X, for each occurrence, independently, is selected from the group consisting of adenosine, guanosine, uridine, cytidine, and chemically-modified derivatives thereof; 
         Y, for each occurrence, independently, is selected from the group consisting of adenosine, guanosine, uridine, cytidine, and chemically-modified derivatives thereof; 
         - represents a phosphodiester internucleoside linkage; 
         =represents a phosphorothioate internucleoside linkage; or 
         --- represents, individually for each occurrence, a base-pairing interaction or a mismatch; or 
         having a structure of formula (V): 
       
       
         
           
           
               
               
           
         
         wherein: 
         X for each occurrence, independently, is a nucleotide comprising a 2′-deoxy-2′-fluoro modification; 
         X, for each occurrence, independently, is a nucleotide comprising a 2′-O-methyl modification; 
         Y for each occurrence, independently, is a nucleotide comprising a 2′-deoxy-2′-fluoro modification; or 
         Y, for each occurrence, independently, is a nucleotide comprising a 2′-O-methyl modification. 
       
     
     
         76 - 91 . (canceled) 
     
     
         92 . A pharmaceutical composition for inhibiting expression of a C9ORF72 gene in an organism, comprising the branched oligonucleotide compound of  claim 103  and a pharmaceutically acceptable carrier, optionally wherein the branched oligonucleotide compound inhibits the expression of said C9ORF72 gene by at least 50% or at least 90%. 
     
     
         93 - 94 . (canceled) 
     
     
         95 . A method for inhibiting expression of a C9ORF72 gene in a cell, the method comprising:
 (a) introducing the branched oligonucleotide compound of  claim 103  into the cell; and   (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the C9ORF72 gene, thereby inhibiting expression of the C9ORF72 gene in the cell.   
     
     
         96 . A method of treating or managing a neurodegenerative disease comprising administering a therapeutically effective amount of the branched oligonucleotide compound of  claim 103  to a patient in need of such treatment or management, optionally wherein:
 the branched oligonucleotide compound is administered to the brain of the patient; 
 the branched oligonucleotide compound is administered by intracerebroventricular (ICV) or intrathecal (IT) injection; 
 administering the branched oligonucleotide compound causes a decrease in C9ORF72 gene mRNA in the brain; 
 administering the branched oligonucleotide compound causes a decrease in C9ORF72 gene mRNA in the spinal cord; or 
 the branched oligonucleotide compound inhibits the expression of the C9ORF72 gene by at least 50% or at least 90%. 
 
     
     
         97 - 102 . (canceled) 
     
     
         103 . A branched oligonucleotide compound comprising two nucleic acids that each independently are between 15 and 35 bases in length, each nucleic acid comprising a region of complementarity, which is substantially complementary to C9ORF72 mRNA, wherein the two nucleic acids are connected to one another by one or more moieties independently selected from the group consisting of a linker, a spacer and a branching point. 
     
     
         104 . The branched oligonucleotide compound of  claim 103 , wherein each nucleic acid independently comprises a region of complementarity, which is substantially complementary to a gene region in the C9ORF72 gene as recited in Table 1, Table 2, Table 3, Table 4, or Table 5. 
     
     
         105 . (canceled) 
     
     
         106 . A di-branched oligonucleotide compound comprising: a first guide strand, a second guide strand, a first passenger strand, a second passenger strand, and a linker, wherein:
 the first guide strand and the second guide strand each independently comprise a region of complementarity, which is substantially complementary to 5′ GAUUAACCAGAAGAA 3′; and   the first passenger strand and the second passenger strand are connected to one another through the linker.   
     
     
         107 . The di-branched oligonucleotide compound of  claim 106 , wherein:
 the first guide strand and the second guide strand each independently include 5′ VP(mU)#(fU)#(mC)(fU)(fU)(fC)(mU)(fG)(mG)(fU)(mU)(fA)(mA)#(fU)#(mC)#(mU)#(mU)#(m U)#(mA)#(fU) 3′; and/or   the first passenger strand and the second passenger strand each include 5′ (mG)#(mA)#(fU)(mU)(fA)(mA)(fC)(mC)(fA)(mG)(mA)(mA)(fG)#(mA)#(mA) 3′.   
     
     
         108 . (canceled) 
     
     
         109 . The di-branched oligonucleotide compound of  claim 106 , wherein the linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a peptide, an RNA oligonucleotide, a DNA oligonucleotide, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof;
 wherein any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, optionally bears a hydroxyl substituent, or optionally bears an oxo substituent: or
 the linker is selected from the group consisting of: 
 a glycerol or a glycerol homolog chain of the formula —O—(CH 2 ) o —CH(OH)—(CH 2 ) p —O—, wherein o and p independently are integers from 1 to about 6; and 
   a derivative of 1,3-diamino-2-hydroxypropane of the formula —O—(CH 2 ) m —C(O)NH—CH 2 —CH(OH)—CH 2 —NHC(O)—(CH 2 ) m —O—, wherein m is an integer from 0 to about 10,
 optionally wherein the 3′ end of the first passenger strand is attached through the linker to the 3′ end of the second passenger strand. 
   
     
     
         110 - 111 . (canceled) 
     
     
         112 . A method of treating or managing a neurodegenerative disease comprising administering to a patient in need of such treatment or management a therapeutically effective amount of the di-branched oligonucleotide compound of  claim 106 , optionally wherein:
 the di-branched oligonucleotide compound is administered to the brain of the patient;   the di-branched oligonucleotide compound is administered by intracerebroventricular (ICV) or intrathecal injection;   administering the di-branched oligonucleotide compound causes a decrease in C9ORF72 disease isoform gene mRNA in the brain;   administering the di-branched oligonucleotide compound causes a decrease in C9ORF72 disease isoform gene mRNA in the spinal cord; or   the di-branched oligonucleotide compound inhibits the expression of a C9ORF72 disease isoform gene by at least 50% or at least 90%.   
     
     
         113 - 118 . (canceled) 
     
     
         119 . The branched oligonucleotide compound of  claim 103 , wherein each nucleic acid independently comprises a region of complementarity, which is substantially complementary to 
       
         
           
                 
               
                   5′AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA3′. 
                 
             
                
               
            
           
         
       
     
     
         120 . The branched oligonucleotide compound of  claim 103 , wherein at least one of the regions of complementarity is substantially complementary to 5′ AUAAAGAUUAACCAGAAGAA 3′, optionally comprising 2, 3, 4, 6, or 8 nucleic acids. 
     
     
         121 . The branched oligonucleotide compound of  claim 103 , wherein the nucleic acids are double stranded (ds) RNA, each nucleic acid comprises a sense strand and an antisense strand, wherein the dsRNA optionally comprises one or more of the following:
 each antisense strand comprises a region of complementarity, which is substantially complementary to SEQ ID NO: 1;   each antisense strand comprises a region of complementarity, which is complementary to at least 10, 11, 12 or 13 contiguous nucleotides of SEQ ID NO: 1;   each antisense strand comprises a region of complementarity comprising no more than 3 mismatches with SEQ ID NO: 1;   each antisense strand comprises a region of complementarity, which is fully complementary to SEQ ID NO: 1;   the dsRNA of at least one nucleic acid comprises at least one modified nucleotide, optionally chosen from the group consisting of a 2′-O-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group;   the dsRNA of at least one nucleic acid is at least 80% chemically modified;   the dsRNA of at least one nucleic acid is fully chemically modified; or   each dsRNA is connected to a linker, spacer or branching point at the 3′ end or at the 5′ end of the sense strand or the antisense strand, wherein each linker is optionally independently selected from the group consisting of an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof;   wherein any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, bears a hydroxyl substituent, or bears an oxo substituent.