Genetic markers for diagnosis of tuberculosis caused by mycobacterium tuberculosis

Abstract

The application is related to novel signature sequences for diagnosis of Mycobacterium tuberculosis in clinical samples with 100% specificity and a very high degree of sensitivity.

1 : A method of detecting  Mycobacterium tuberculosis  in a clinical sample, said method comprising the steps of:
 a) removal of contaminants from the clinical sample to generate a contaminant-free clinical sample;   b) extraction of genomic DNA from the contaminant-free clinical sample;   c) designing a set of specific oligonucleotide primers capable of specifically detecting SEQ ID NO: 2 for use in RT-PCR;   d) performing PCR with the oligonucleotide primers of step c) on the genomic DNA of step b) to produce a PCR product; and   e) analyzing the PCR product obtained in step d) by electrophoresis or a specific probe nucleotide sequence complementary to SEQ ID NO: 2.   
     
     
         2 : The method of  claim 1 , wherein the set of oligonucleotide primers are selected from: 
       
         
           
                 
               
                   (i)  
                 
                   (SEQ ID NO: 7) 
                 
                   5′ GTGTTTGCGTTGAGTAATAATCTGAACCGTGT 3′ 
                 
                   and 
                 
                     
                 
                   (SEQ ID NO: 8) 
                 
                   3′ AGCCAATTCCAGCACGATGTCGCC 5′; 
                 
             
                
                
                
                
                
                
                
               
            
           
         
         (ii) a set of oligonucleotide primers complementary to (i); 
         or 
         (iii) a set of oligonucleotide primers comprising a sequence containing any 10 consecutive bases from the sequence of SEQ ID NO: 2. 
       
     
     
         3 : The method of  claim 1 , wherein the clinical sample is isolated from individuals vaccinated against tuberculosis. 
     
     
         4 : The method of  claim 1 , wherein the clinical sample is isolated from individuals treated against tuberculosis.