Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

1 - 32 . (canceled) 
     
     
         33 . A method of guiding a Cas9 protein to a target DNA in a eukaryotic cell, the method comprising:
 introducing into a eukaryotic cell:
 (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and 
 (b) a single-molecule DNA-targeting RNA or a nucleic acid encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA comprises a 103 nucleotide (nt) sequence that comprises, in 5′ to 3′ order:
 a 20 nucleotide (nt) targeting sequence that is complementary to and hybridizes with a target sequence in a target DNA within the eukaryotic cell, GUUUUAGAGCUA (SEQ ID NO: 679), which is a 12 nt crRNA sequence, GAAA, which is a 4 nt linker sequence, and UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUUUUUU (SEQ ID NO: 432), which is a 67 nt tracrRNA sequence, 
 
 wherein the single-molecule DNA-targeting RNA forms a complex with the Cas9 protein, and the Cas9 protein is thereby guided to the target DNA. 
   
     
     
         34 . A method of modifying a chromosomal target DNA in a eukaryotic cell, the method comprising:
 introducing into a eukaryotic cell:
 (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and 
 (b) a DNA-targeting RNA or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:
 a DNA-targeting segment with a targeting sequence that is complementary to and hybridizes with a target sequence in a chromosomal target DNA; and 
 a protein-binding segment that: (i) comprises two complementary stretches of nucleotides that hybridize to form a double stranded RNA duplex; and (ii) interacts with the Cas9 protein, 
 
 wherein the DNA-targeting RNA forms a complex with the Cas9 protein, and the Cas9 protein cleaves the chromosomal target DNA in a site-specific manner, 
 wherein the DNA-targeting segment of the DNA-targeting RNA is about 20-50 nucleotides long, and 
 the protein-binding segment of the DNA-targeting RNA is about 80 or about 100 nucleotides long. 
   
     
     
         35 . The method of  claim 34 , wherein the DNA-targeting RNA is a single-molecule DNA-targeting RNA and said two complementary stretches of nucleotides are covalently linked by intervening nucleotides. 
     
     
         36 . A composition comprising a single-molecule DNA-targeting RNA or a nucleic acid encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA is capable of interacting with a Cas9 protein and comprises a 103 nucleotide (nt) sequence that comprises, in 5′ to 3′ order:
 a 20 nucleotide (nt) targeting sequence that is complementary to and capable of hybridizing with a target sequence in a target DNA; 
 a 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), 
 a 4 nt linker sequence GAAA, and 
 a 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUUUUUU (SEQ ID NO: 432). 
 
     
     
         37 . A composition comprising:
 (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and   (b) a single-molecule DNA-targeting RNA or a nucleic acid encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA comprises:
 a DNA-targeting segment with a targeting sequence that is complementary to and hybridizes with a target sequence in a chromosomal target DNA; and 
 a protein-binding segment that: (i) comprises two complementary stretches of nucleotides that hybridize to form a double stranded RNA duplex, wherein said two complementary stretches of nucleotides are covalently linked by intervening nucleotides; and (ii) is capable of interacting with the Cas9 protein, 
   wherein the DNA-targeting segment is about 20 nucleotides long and   the protein-binding segment is about 80 or about 100 nucleotides long.   
     
     
         38 . A method of modulating transcription from a target DNA in a eukaryotic cell, the method comprising:
 introducing into a eukaryotic cell:   (a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, where in the chimeric Cas9 protein comprises a Cas9 polypeptide that: (i) has substantially no nuclease activity, (ii) comprises a mutation in a RuvC domain and a mutation in an HNH domain, and (iii) is fused to a heterologous polypeptide; and   (b) a single-molecule DNA-targeting RNA or a nucleic acid encoding the single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA forms a complex with the chimeric Cas9 protein and hybridizes with a target sequence of a target DNA,   wherein the complex is guided to the target sequence by the single-molecule DNA-targeting RNA, and wherein the heterologous polypeptide comprises a transcriptional activator that increases transcription from the target DNA or comprises a transcriptional repressor that decreases transcription from the target DNA,   wherein the single-molecule DNA-targeting RNA comprises a nucleotide (nt) sequence of 103 nt that comprises, in 5′ to 3′ order:
 a 20 nt targeting sequence that is complementary to and hybridizes with the target sequence of the target DNA, GUUUUAGAGCUA (SEQ ID NO: 679), which is a 12 nt crRNA sequence, GAAA, which is a 4 nt linker sequence, and UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUUUUUU (SEQ ID NO: 432), which is a 67 nt tracrRNA sequence. 
   
     
     
         39 . The method of  claim 33 , wherein the eukaryotic cell is a yeast cell, plant cell, a stem cell, a human cell, a human stem cell, or a human induced pluripotent stem cell. 
     
     
         40 . The method of  claim 33 , wherein the eukaryotic cell is a stem cell, the target DNA is chromosomal DNA, and the Cas9 protein cleaves the chromosomal DNA. 
     
     
         41 . The method of  claim 39 , wherein the target DNA is chromosomal DNA and the method:
 (A) comprises introducing a donor polynucleotide into the eukaryotic cell and the method results in insertion of a sequence of the donor polynucleotide into the chromosomal DNA; or   (B) results in nonhomologous end joining due to cleavage of the chromosomal DNA by the Cas9 protein; or   (C) results in homologous recombination due to cleavage of the chromosomal DNA by the Cas9 protein.   
     
     
         42 . The method of  claim 34 , wherein the eukaryotic cell is a plant cell, a stem cell, a human cell, a human stem cell, or a human induced pluripotent stem cell. 
     
     
         43 . The method of  claim 33 , wherein the method comprises introducing two or more single-molecule DNA-targeting RNAs or one or more nucleic acids encoding said two or more single-molecule DNA-targeting RNAs into the cell, wherein each of the two or more single-molecule DNA-targeting RNAs hybridize with a different target sequences on the target DNA. 
     
     
         44 . The method of  claim 34 , wherein the method comprises introducing two or more single-molecule DNA-targeting RNAs or one or more nucleic acids encoding said two or more single-molecule DNA-targeting RNAs into the cell, wherein each of the two or more single-molecule DNA-targeting RNAs hybridize with a different target sequences on the target DNA. 
     
     
         45 . The method of  claim 34 , wherein said targeting sequence is 20 nucleotides long. 
     
     
         46 . The method of  claim 34 , wherein the Cas9 protein comprises a C-terminal conjugated protein transduction domain (PTD) that aids in traversal of the Cas9 protein from the mammalian cell's cytosol to within an organelle, wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         47 . The method of  claim 34 , wherein the Cas9 protein comprises an N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the Cas9 protein from the mammalian cell's cytosol to within an organelle, wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         48 . The method of  claim 47 , wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type Cas9 nucleotide sequence with one or more different codons encoding the same amino acid 
     
     
         49 . The method of  claim 33 , wherein the Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the Cas9 protein from the mammalian cell's cytosol to within an organelle. 
     
     
         50 . The method of  claim 49 , wherein the nucleotide sequence encoding the Cas9 protein is modified to replace one or more codons of a wild-type Cas9 nucleotide sequence with one or more different codons encoding the same amino acid 
     
     
         51 . The method of  claim 49 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         52 . The method of  claim 33 , wherein the nucleic acid encoding the Cas9 protein and/or the nucleic acid encoding the single-molecule DNA-targeting RNA is introduced into said cell using an adeno-associated virus. 
     
     
         53 . The method of  claim 34 , wherein the nucleic acid encoding the Cas9 protein and/or the nucleic acid encoding the single-molecule DNA-targeting RNA is introduced into said cell using an adeno-associated virus. 
     
     
         54 . The method of  claim 33 , wherein the method results in an insertion or a deletion of sequence in the target DNA. 
     
     
         55 . The method of  claim 33 , wherein the method results in insertion of a nucleotide sequence into the target DNA. 
     
     
         56 . The method of  claim 33 , wherein the method comprises introducing a donor polynucleotide into the eukaryotic cell and the method results in insertion of a sequence of the donor polynucleotide into the target DNA. 
     
     
         57 . The method of  claim 33 , wherein the Cas9 protein cleaves the target DNA, resulting in nonhomologous end joining. 
     
     
         58 . The method of  claim 33 , wherein the Cas9 protein cleaves the target DNA, resulting in homology directed repair. 
     
     
         59 . The method of  claim 34 , wherein the method comprises introducing a donor polynucleotide into the eukaryotic cell and the method results in insertion of a sequence of the donor polynucleotide into the target DNA. 
     
     
         60 . The method of  claim 33 , wherein said introducing results in deletion of a nucleotide sequence from the target DNA. 
     
     
         61 . The method of  claim 33 , wherein said introducing results in modification of the target DNA, thereby altering the eukaryotic cell. 
     
     
         62 . The method of  claim 33 , wherein transcription from the target DNA in the eukaryotic cell is altered as a result of said introducing. 
     
     
         63 . The method of  claim 34 , wherein a sequence is deleted from the target DNA as a result of nonhomologous end joining due to cleavage of the target DNA by the Cas9 protein. 
     
     
         64 . The method of  claim 63 , wherein the eukaryotic cell is a plant cell, a stem cell, a human cell, a human stem cell, or a human induced pluripotent stem cell. 
     
     
         65 . The method of  claim 33 , wherein said introducing results in a gene knockout. 
     
     
         66 . The method of  claim 34 , wherein said introducing results in a gene knockout. 
     
     
         67 . The method of  claim 33 , wherein the target DNA is a chromosomal DNA. 
     
     
         68 . The method of  claim 33 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 
     
     
         69 . The method of  claim 34 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 
     
     
         70 . The method of  claim 38 , wherein the method comprises introducing two or more single-molecule DNA-targeting RNAs or one or more nucleic acids encoding said two or more single-molecule DNA-targeting RNAs into the cell, wherein each of the two or more single-molecule DNA-targeting RNAs hybridize with a different target sequences on the target DNA. 
     
     
         71 . The method of  claim 38 , wherein the chimeric Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the chimeric Cas9 protein from the mammalian cell's cytosol to within an organelle, and wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         72 . The method of  claim 38 , wherein the nucleotide sequence encoding the chimeric Cas9 protein is modified to replace one or more codons of a wild-type nucleotide sequence with one or more different codons encoding the same amino acid. 
     
     
         73 . The method of  claim 38 , wherein the eukaryotic cell is a yeast cell, plant cell, mammalian cell, or human cell. 
     
     
         74 . The method of  claim 38 , wherein the eukaryotic cell is a stem cell, a human stem cell, an induced pluripotent stem cell, or a human induced pluripotent stem cell. 
     
     
         75 . The method of  claim 35 , wherein the eukaryotic cell is a plant cell, a stem cell, a human cell, a human stem cell, or a human induced pluripotent stem cell. 
     
     
         76 . The method of  claim 35 , wherein the method comprises introducing two or more single-molecule DNA-targeting RNAs or one or more nucleic acids encoding said two or more single-molecule DNA-targeting RNAs into the cell, wherein each of the two or more single-molecule DNA-targeting RNAs hybridize with a different target sequences on the target DNA. 
     
     
         77 . The method of  claim 35 , wherein said targeting sequence is 20 nucleotides long. 
     
     
         78 . The method of  claim 35 , wherein the Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the Cas9 protein from the mammalian cell's cytosol to within an organelle, wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         79 . The method of  claim 35 , wherein the nucleic acid encoding the Cas9 protein and/or the nucleic acid encoding the single-molecule DNA-targeting RNA is introduced into said cell using an adeno-associated virus. 
     
     
         80 . The method of  claim 35 , wherein the method comprises introducing a donor polynucleotide into the eukaryotic cell and the method results in insertion of a sequence of the donor polynucleotide into the target DNA. 
     
     
         81 . The method of  claim 35 , wherein a sequence is deleted from the target DNA as a result of nonhomologous end joining due to cleavage of the target DNA by the Cas9 protein. 
     
     
         82 . The method of  claim 81 , wherein the eukaryotic cell is a plant cell, a stem cell, a human cell, a human stem cell, or a human induced pluripotent stem cell. 
     
     
         83 . The method of  claim 35 , wherein said introducing results in a gene knockout. 
     
     
         84 . The method of  claim 35 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 
     
     
         85 . A eukaryotic cell comprising the composition of  claim 36 . 
     
     
         86 . The composition of  claim 36 , wherein the nucleic acid encoding the single-molecule DNA-targeting RNA comprises a regulatory element operable in a eukaryotic cell. 
     
     
         87 . The composition of  claim 36 , further comprising the Cas9 protein or a nucleic acid encoding the Cas9 protein. 
     
     
         88 . A eukaryotic cell comprising the composition of  claim 37 . 
     
     
         89 . A method of increasing transcription from a target DNA in a mammalian cell, the method comprising:
 contacting a target DNA in a mammalian cell in vitro with:   (c) a chimeric Cas9 protein comprising a  S. pyogenes  Cas9 polypeptide that: (i) has substantially no nuclease activity, (ii) comprises a mutation in a RuvC domain and a mutation in an HNH domain, and (iii) is fused to a heterologous polypeptide; and   (d) a DNA-targeting RNA that forms a complex with the chimeric Cas9 protein and hybridizes with a target sequence of the target DNA,   wherein the complex is guided to the target sequence by the DNA-targeting RNA, and wherein the heterologous polypeptide comprises a transcriptional activator that increases transcription from the target DNA.   
     
     
         90 . The method of  claim 89 , wherein said contacting results in increased transcription of a protein-encoding gene. 
     
     
         91 . The method of  claim 89 , wherein said contacting comprises introducing into the mammalian cell: an expression vector comprising a promoter operably linked to a nucleotide sequence encoding the chimeric Cas9 protein, and an expression vector comprising a promoter operably linked to a nucleotide sequence encoding the DNA-targeting RNA. 
     
     
         92 . The method of  claim 90 , wherein said contacting comprises introducing into the mammalian cell: an expression vector comprising a promoter operably linked to a nucleotide sequence encoding the chimeric Cas9 protein, and an expression vector comprising a promoter operably linked to a nucleotide sequence encoding the DNA-targeting RNA. 
     
     
         93 . The method of  claim 89 , wherein the chimeric Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the chimeric Cas9 protein from the mammalian cell's cytosol to within an organelle. 
     
     
         94 . The method of  claim 90 , wherein the chimeric Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the chimeric Cas9 protein from the mammalian cell's cytosol to within an organelle. 
     
     
         95 . The method of  claim 91 , wherein the chimeric Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the chimeric Cas9 protein from the mammalian cell's cytosol to within an organelle. 
     
     
         96 . The method of  claim 92 , wherein the chimeric Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the chimeric Cas9 protein from the mammalian cell's cytosol to within an organelle. 
     
     
         97 . The method of  claim 93 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         98 . The method of  claim 94 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         99 . The method of  claim 95 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         100 . The method of  claim 96 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         101 . The method of  claim 89 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag. 
     
     
         102 . The method of  claim 90 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag. 
     
     
         103 . The method of  claim 93 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag. 
     
     
         104 . The method of  claim 94 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag. 
     
     
         105 . The method of  claim 98 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag. 
     
     
         106 . A method of gene regulation, the method comprising:
 contacting a target DNA in a mammalian cell in vitro with:   (a) a chimeric Cas9 protein comprising a  S. pyogenes  Cas9 polypeptide that: (i) has substantially no nuclease activity, (ii) comprises a mutation in a RuvC domain and a mutation in an HNH domain, and (iii) is fused to a heterologous polypeptide; and   (b) a DNA-targeting RNA that forms a complex with the chimeric Cas9 protein and hybridizes with a target sequence of the target DNA,   wherein the complex is guided to the target sequence by the DNA-targeting RNA, and wherein the heterologous polypeptide has methyltransferase or demethylase activity that modifies the target DNA, resulting in gene regulation.   
     
     
         107 . The method of  claim 106 , wherein the chimeric Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the chimeric Cas9 protein from the mammalian cell's cytosol to within an organelle. 
     
     
         108 . The method of  claim 107 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         109 . The method of  claim 107 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag. 
     
     
         110 . The method of  claim 108 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag. 
     
     
         111 . A method of histone modification, the method comprising:
 contacting a target DNA in a mammalian cell in vitro with:   (a) a chimeric Cas9 protein comprising a  S. pyogenes  Cas9 polypeptide that: (i) has substantially no nuclease activity, (ii) comprises a mutation in a RuvC domain and a mutation in an HNH domain, and (iii) is fused to a heterologous polypeptide; and   (b) a DNA-targeting RNA that forms a complex with the chimeric Cas9 protein and hybridizes with a target sequence of the target DNA,   wherein the complex is guided to the target sequence by the DNA-targeting RNA, and wherein the heterologous polypeptide has histone-modifying activity that can modify histones associated with the target DNA.   
     
     
         112 . The method of  claim 111 , wherein the histone modifying activity is methyltransferase activity, demethylase activity, or acetyltransferase activity. 
     
     
         113 . The method of  claim 111 , wherein the chimeric Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the chimeric Cas9 protein from the mammalian cell's cytosol to within an organelle. 
     
     
         114 . The method of  claim 112 , wherein the chimeric Cas9 protein comprises a C-terminal or N-terminal conjugated protein transduction domain (PTD) that aids in traversal of the chimeric Cas9 protein from the mammalian cell's cytosol to within an organelle. 
     
     
         115 . The method of  claim 113 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         116 . The method of  claim 114 , wherein the PTD comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 268) or RKKRRQRRR (SEQ ID NO: 269). 
     
     
         117 . The method of  claim 114 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag. 
     
     
         118 . The method of  claim 116 , wherein the chimeric Cas9 protein is fused to a heterologous polypeptide that comprises a 6×His protein tag.