Neuroprotective molecules and methods of treating neurological disorders and inducing stress granules

Abstract

Provided herein are neuroprotective molecules containing a sequence of 25-35 contiguous nucleotides between nucleotide 1 and nucleotide 50 of a mature human tRNA and at least four contiguous guanosine-containing nucleotides, where the sequence of 25-35 contiguous nucleotides contains a D-loop stem structure, the at least four contiguous guanosine-containing nucleotides are located at the 5′ end of the neuroprotective molecule, and the neuroprotective molecule contains at least one deoxyribonucleotide. Also provided are neuroprotective molecules containing a sequence of 25-35 contiguous nucleotides between nucleotide 1 and nucleotide 50 of a mature human tRNACYS; and at least four contiguous guanosine-containing nucleotides, where the sequence of 25-35 contiguous nucleotides contains a D-loop stem structure and the at least four contiguous guanosine-containing nucleotides are located at the 5′ end of the neuroprotective molecule.

What is claimed is: 
     
         1 . A neuroprotective molecule comprising:
 a sequence of 25-35 contiguous nucleotides that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; and   at least four contiguous guanosine-containing nucleotides;   wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure, the at least four contiguous guanosine-containing nucleotides are located at the 5′ end of the neuroprotective molecule, and the neuroprotective molecule comprises at least one deoxyribonucleotide.   
     
     
         2 . The neuroprotective molecule of  claim 1 , wherein the sequence of 25-35 contiguous nucleotides is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA having a sequence selected from the group consisting of SEQ ID NOS: 4, 5, 8-11, 13-17, 32, 37, and 40-173. 
     
     
         3 . A neuroprotective molecule comprising:
 a sequence of 25-35 contiguous nucleotides that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA selected from the group consisting of: tRNA Arg , tRNA Asp , tRNA Glu , tRNA Gln , tRNA Gly , tRNA His , tRNA Ile , tRNA Leu , tRNA Lys , tRNA Met , tRNA Pro , tRNA SeC , tRNA Ser , tRNA Sup , tRNA Thr , tRNA Trp , tRNA Tyr , tRNA Val , tRNA Asn , and tRNA Phe ; and   at least four contiguous guanosine-containing nucleotides;   wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure and the at least four contiguous guanosine-containing nucleotides are located at the 5′ end of the neuroprotective molecule.   
     
     
         4 . A neuroprotective molecule of  claim 3 , wherein the sequence of 25-35 contiguous nucleotides is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA having a sequence selected from the group consisting of SEQ ID NOS: 5, 8, 9, 11, 14-17, 32, 37, 56, 57, and 63-173. 
     
     
         5 . The neuroprotective molecule of  claim 4 , wherein the sequence of 25-35 contiguous nucleotides is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA having a sequence selected from the group of SEQ ID NOS: 11 and 107-116. 
     
     
         6 . The neuroprotective molecule of  claim 1 , wherein the neuroprotective molecule further comprises a 5′-monophosphate. 
     
     
         7 . The neuroprotective molecule of  claim 1 , wherein the neuroprotective molecule comprises at least one modified nucleotide. 
     
     
         8 . The neuroprotective molecule of  claim 7 , wherein the modified nucleotide contains a modified base or a modified sugar. 
     
     
         9 . The neuroprotective molecule of  claim 1 , wherein the neuroprotective molecule contains at least one modification in the phosphate backbone. 
     
     
         10 . The neuroprotective molecule of  claim 1 , wherein the neuroprotective molecule contains a 5′- or a 3′-protective group. 
     
     
         11 . The neuroprotective molecule of  claim 1 , wherein the neuroprotective molecule has a total length of between 39 to 60 nucleotides. 
     
     
         12 . A pharmaceutical composition comprising at least one neuroprotective molecule of  claim 1 . 
     
     
         13 . A method of inducing or increasing stress granule formation in a cell, the method comprising administering to a cell a neuroprotective molecule of  claim 1 , or an isolated C-myc oligonucleotide comprising the sequence of GGGGAGGGTGGGGAGGGT GGGG (SEQ ID NO: 174), wherein the neuroprotective molecule or the isolated C-myc oligonucleotide is administered in an amount sufficient to induce or increase stress granule formation in the cell. 
     
     
         14 . A method of decreasing protein translation in a cell, the method comprising administering to a cell a neuroprotective molecule of  claim 1 , or an isolated C-myc oligonucleotide comprising the sequence of GGGGAGGGTGGGGAGGGTGGGG (SEQ ID NO: 174), where the neuroprotective molecule or the isolated C-myc oligonucleotide is administered in an amount sufficient to decrease protein translation in the cell. 
     
     
         15 . A method of decreasing stress-induced cell death, the method comprising administering to a cell a neuroprotective molecule of  claim 1 , or an isolated C-myc oligonucleotide comprising the sequence of GGGGAGGGTGGGGAGGGTGGGG (SEQ ID NO: 174), where the neuroprotective molecule or the isolated C-myc oligonucleotide is administered in an amount sufficient to decrease cell death. 
     
     
         16 . The method of  claim 13 , wherein the cell is in vitro. 
     
     
         17 . The method of  claim 13 , wherein the cell is in vivo. 
     
     
         18 . The method of  claim 16 , wherein the cell is a neuron. 
     
     
         19 . The method of  claim 18 , wherein the cell is a motor neuron. 
     
     
         20 . A method of treating a neurological disorder associated with neuron death in a subject, the method comprising administering a neuroprotective molecule of  claim 1 , or an isolated C-myc oligonucleotide comprising the sequence of GGGGAGGGTGGGGAGGGTGGGG (SEQ ID NO: 174), wherein the neuroprotective molecule or the isolated C-myc oligonucleotide is administered in an amount sufficient to treat the neurological disorder associated with neuron death in the subject. 
     
     
         21 . The method of  claim 20 , wherein the neurological disorder associated with neuron death is selected from the group consisting of: amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, muscular dystrophy, multiple sclerosis, and stroke. 
     
     
         22 . The method of  claim 20 , wherein the neuroprotective molecule or the isolated C-myc oligonucleotide is administered intravenously, intraarterially, intracranially, ocularly, intraperitoneally, subcutaneously, or intramuscularly.