US2019376052A1PendingUtilityA1

Glucanases, nucleic acids encoding them and methods for making and using them

Assignee: BP CORP NORTH AMERICA INCPriority: Aug 4, 2006Filed: May 28, 2019Published: Dec 12, 2019
Est. expiryAug 4, 2026(~0 yrs left)· nominal 20-yr term from priority
A61P 43/00A61P 31/04A61P 1/14C12Q 1/686A01H 6/46A01H 6/14C12N 9/2437G16B 30/00C09K 8/74A23K 20/147C12Y 302/01039C09K 8/90C12Y 302/01006C12Y 302/01004C12N 9/2405C12Y 302/01008C12N 9/2482A23L 33/18C12P 19/14C12P 19/02C09K 8/035C09K 2208/24C09K 8/52C09K 8/68C12N 9/2491C12Q 1/6876C12N 9/244C09K 8/805C12Y 302/01025E21B 43/26Y02E50/17G16B 30/20G16B 30/10Y02E50/10
55
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention relates to polypeptides having glucanase, e.g., endoglucanase, mannanase, xylanase activity or a combination of these activities, and polynucleotides encoding them. In one aspect, the glucanase activity is an endoglucanase activity (e.g., endo-1,4-beta-D-glucan 4-glucano hydrolase activity) and comprises hydrolysis of 1,4-beta-D-glycosidic linkages in cellulose, cellulose derivatives (e.g., carboxy methyl cellulose and hydroxy ethyl cellulose) lichenin, beta-1,4 bonds in mixed beta-1,3 glucans, such as cereal beta-D-glucans or xyloglucans and other plant material containing cellulosic parts. In addition, methods of designing new enzymes and methods of use thereof are also provided. In alternative aspects, the new glucanases e.g., endoglucanases, mannanases, xylanases have increased activity and stability, including thermotolerance or thermostability, at increased or decreased pHs and temperatures.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
         1 . An isolated, synthetic or recombinant nucleic acid comprising:
 (a) (i) a nucleic acid sequence having at least; 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a nucleic acid sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:12, SEQ ID NO: 18, SEQ ID NO:20, OR SEQ ID NO:22, or
 (ii) a nucleic acid (polynucleotide) sequence that hybridizes under stringent conditions to a nucleic acid comprising SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 18, SEQ ID NO:20, OR SEQ ID NO:22, and the stringent conditions comprise a wash step comprising a wash in 0.2×SSC at a temperature of about 65° C. for about 15 minutes; 
 wherein the nucleic acid of (i) or (ii) encodes at least one polypeptide having a glucanase activity SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:19, SEQ ID NO:21, and/or SEQ ID NO:23, 
   and the nucleic acid sequence of (i) or (ii) comprises at least one, two, three, four, five, six, seven, eight, nine, ten, eleven (11), twelve (12), 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 or 70 or more or all of the following nucleotide residue changes based on the sequence of SEQ ID NO: 1:   
       the nucleotides at positions 4 to 6 are AAT or AAC, 
       the nucleotides at positions 37 to 39 are AAT or AAC, 
       the nucleotides at positions 112 to 114 are TAT or TAC, 
       the nucleotides at positions 169 to 171 are GAT or GAC, 
       the nucleotides at positions 181 to 183 are CAA or CAG, 
       the nucleotides at positions 181 to 183 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 184 to 186 are ACT, ACC, ACA or ACG, 
       the nucleotides at positions 187 to 189 are CAT or CAC, 
       the nucleotides at positions 187 to 189 are ACT, ACC, ACA or ACG, 
       the nucleotides at positions 205 to 207 are GAA or GAG, 
       the nucleotides at positions 205 to 207 are CAT or CAC, 
       the nucleotides at positions 205 to 207 are CAA or CAG, 
       the nucleotides at positions 205 to 207 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 205 to 207 are TAT or TAC, 
       the nucleotides at positions 208 to 210 are CCA, CCC, CCG or CCT, 
       the nucleotides at positions 211 to 213 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 211 to 213 are GAA or GAG, 
       the nucleotides at positions 211 to 213 are CCA, CCC, CCG or CCT, 
       the nucleotides at positions 211 to 213 are CAA or CAG, 
       the nucleotides at positions 211 to 213 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 211 to 213 are ACT, ACC, ACA or ACG, 
       the nucleotides at positions 220 to 222 are GAA or GAG, 
       the nucleotides at positions 220 to 222 are TTA, TTG, CTT, CTC, CTA or CTG, 
       the nucleotides at positions 220 to 222 are ATG, 
       the nucleotides at positions 280 to 282 are CAA or CAG, 
       the nucleotides at positions 301 to 303 are TAT or TAC, 
       the nucleotides at positions 307 to 309 are TGT or TGC, 
       the nucleotides at positions 307 to 309 are CAA or CAG, 
       the nucleotides at positions 316 to 318 are GGT, GGC, GGA or GGG, 
       the nucleotides at positions 325 to 327 are TTA, TTG, CTT, CTC, CTA or CTG, 
       the nucleotides at positions 346 to 348 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 346 to 348 are CGT, CGC, CGA, CGG, AGA or AGG, 
       the nucleotides at positions 388 to 390 are TAT or TAC, 
       the nucleotides at positions 391 to 393 are TTA, TTG, CTT, CTC, CTA or CTG, 
       the nucleotides at positions 442 to 444 are CAT or CAC, 
       the nucleotides at positions 484 to 486 are CAA or CAG, 
       the nucleotides at positions 496 to 498 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 496 to 498 are GTT, GTC, GTA or GTG, 
       the nucleotides at positions 547 to 549 are CGT, CGC, CGA, CGG, AGA or AGG, 
       the nucleotides at positions 547 to 549 are GTT, GTC, GTA or GTG, 
       the nucleotides at positions 556 to 558 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 556 to 558 are GAT or GAC, 
       the nucleotides at positions 556 to 558 are CCA, CCC, CCG or CCT, 
       the nucleotides at positions 556 to 558 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 571 to 573 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 571 to 573 are TGT or TGC, 
       the nucleotides at positions 571 to 573 are TTA, TTG, CTT, CTC, CTA or CTG, 
       the nucleotides at positions 601 to 603 are ATT, ATC or ATA, 
       the nucleotides at positions 601 to 603 are CCA, CCC, CCG or CCT, 
       the nucleotides at positions 601 to 603 are GTT, GTC, GTA or GTG, 
       the nucleotides at positions 634 to 636 are CCA, CCC, CCG or CCT, 
       the nucleotides at positions 646 to 648 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 688 to 690 are AAA or AAG, 
       the nucleotides at positions 688 to 690 are CAA or CAG, 
       the nucleotides at positions 688 to 690 are CGT, CGC, CGA, CGG, AGA or AGG, 
       the nucleotides at positions 691 to 693 are ATT, ATC or ATA, 
       the nucleotides at positions 691 to 693 are ATG, 
       the nucleotides at positions 691 to 693 are GTT, GTC, GTA or GTG, 
       the nucleotides at positions 700 to 702 are GAT or GAC, 
       the nucleotides at positions 736 to 738 are CAA or CAG, 
       the nucleotides at positions 736 to 738 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 772 to 774 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 772 to 774 are TAT or TAC, 
       the nucleotides at positions 784 to 786 are CAT or CAC, 
       the nucleotides at positions 784 to 786 are ATG, 
       the nucleotides at positions 784 to 786 are CCA, CCC, CCG or CCT, 
       the nucleotides at positions 784 to 786 are CAA or CAG, 
       the nucleotides at positions 808 to 810 are CGT, CGC, CGA, CGG, AGA or AGG, 
       the nucleotides at positions 811 to 813 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 826 to 828 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 826 to 828 are TGT or TGC, 
       the nucleotides at positions 826 to 828 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 829 to 831 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 838 to 840 are GGT, GGC, GGA or GGG, 
       the nucleotides at positions 868 to 870 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 889 to 891 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 889 to 891 are CCA, CCC, CCG or CCT, 
       the nucleotides at positions 892 to 894 are GCT, GCC, GCA or GCG, 
       the nucleotides at positions 892 to 894 are AAT or AAC, 
       the nucleotides at positions 892 to 894 are CGT, CGC, CGA, CGG, AGA or AGG, 
       the nucleotides at positions 892 to 894 are TCT, TCC, TCA, TCG, AGT or AGC, 
       the nucleotides at positions 892 to 894 are GTT, GTC, GTA or GTG, 
       the nucleotides at positions 898 to 900 are GGT, GGC, GGA or GGG, 
       the nucleotides at positions 901 to 903 are CAA or CAG, 
       the nucleotides at positions 913 to 915 are CCA, CCC, CCG or CCT, 
       the nucleotides at positions 934 to 936 are ATT, ATC or ATA, and/or 
       the nucleotides at positions 943 to 945 are ATT, ATC or ATA;
 and optionally the sequence identities are determined by analysis with a sequence comparison algorithm or by a visual inspection, and optionally the sequence comparison algorithm is a BLAST version 2.2.2 algorithm where a filtering setting is set to blastall -p blastp -d “nr pataa”-F F, and all other options are set to default; 
 (b) the nucleic acid of (a), wherein the nucleic acid comprises the sequence of SEQ ID NO:6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO:18, SEQ ID NO:20 or SEQ ID NO:22; 
 (c) the nucleic acid (polynucleotide) sequence of (a) or (b) encoding a polypeptide having a glucanase activity but lacking: a signal sequence or proprotein sequence, or a homologous promoter sequence; 
 (d) the nucleic acid (polynucleotide) of (a), (b), or (c) encoding a polypeptide having a glucanase activity and further comprising a heterologous amino acid sequence, or the nucleic acid (polynucleotide) of (a), (b), or (c) comprises a heterologous nucleotide sequence; 
 (e) the nucleic acid (polynucleotide) of (d), wherein the heterologous amino acid sequence comprises, or consists of a sequence encoding a heterologous (leader) signal sequence, or a tag or an epitope, or the heterologous nucleotide sequence comprises a heterologous promoter sequence; 
 (f) the nucleic acid (polynucleotide) of (d) or (e), wherein the heterologous nucleotide sequence encodes a heterologous (leader) signal sequence comprising or consisting of an N-terminal and/or C-terminal extension for targeting to an endoplasmic reticulum (ER) or endomembrane, or to a maize endoplasmic reticulum (ER) or endomembrane system, or the heterologous sequence encodes a restriction site; 
 (g) the nucleic acid (polynucleotide) of (e), wherein the heterologous promoter sequence comprises or consists of a constitutive or inducible promoter, or a cell type specific promoter, or a plant specific promoter, or a maize specific promoter; 
 (h) the nucleic acid (polynucleotide) of any of (a) to (g), wherein the glucanase activity comprises: an endoglucanase activity; catalyzing hydrolysis of 1,4-beta-D-glycosidic linkages or internal β-1,3-glucosidic linkages, hydrolyzing a glucan, a mannan, an arabinoxylan or a xylan to produce a smaller molecular weight polysaccharide or oligomer; an endo-1,4-beta-endoglucanase activity; a 1,4-beta-D-glycosidic linkage activity comprising hydrolysis of a 1,4-beta-D-glycosidic linkage in a cellulose, a cellulose derivative, a lichenin or a cereal, or a cellulose derivative comprising a carboxy methyl cellulose or a hydroxy ethyl cellulose, or a cereal comprising a beta-D-glucan or a xyloglucan; hydrolyzing polysaccharides comprising 1,4-β-glycoside-linked D-glucopyranoses; hydrolyzing a cellulose, a cellulose derivative or a hemicellulose; hydrolyzing a cellulose or a hemicellulose in a wood or paper pulp or a wood or paper product; catalyzing hydrolysis of glucan in a feed, a food product or a beverage, or a feed, food product or beverage comprising a cereal-based animal feed, a wort or a beer, a dough, a fruit or a vegetable; catalyzing hydrolysis of a glucan, a mannan, an arabinoxylan or a xylan, in a microbial cell, a fungal cell, a mammalian cell or a plant cell; 
 (i) the isolated, synthetic or recombinant nucleic acid of any one of (a) to (h), wherein nucleotide residues in a cryptic transcriptional start site are modified to eliminate most or all of the production of a truncated transcript; 
 (j) the isolated, synthetic or recombinant nucleic acid of (i), wherein the nucleotide residue modifications in the cryptic transcriptional start site comprise an alteration in a ribosome binding site (RBS); 
 (k) the isolated, synthetic or recombinant nucleic acid of (i) or (j), wherein the nucleotide residue modifications in the cryptic transcriptional start site comprise the following modifications in residues 77 to 106 of SEQ ID NO: 1 to: ATGAGGGCGACTGGGGAGTCGTGATAAAAG; or equivalent; or 
 (l) a nucleic acid sequence completely complementary to the nucleotide sequence of any of (a) to (k). 
 
     
     
         2 . The isolated, synthetic or recombinant nucleic acid of  claim 1 , wherein the nucleic acid sequence comprises a sequence modification of SEQ ID NO: 1, and
 (a) the isolated, synthetic or recombinant nucleic acid of  claim 1 , wherein the modification comprises:   the nucleotides at positions 112 to 114 are TAT or TAC,   the nucleotides at positions 181 to 183 are CAA or CAG,   the nucleotides at positions 205 to 207 are GAA or GAG,   the nucleotides at positions 280 to 282 are CAA or CAG,   the nucleotides at positions 547 to 549 are CGT, CGC, CGA, CGG, AGA or AGG,   the nucleotides at positions 571 to 573 are GCT, GCC, GCA or GCG, and   the nucleotides at positions 826 to 828 are GCT, GCC, GCA or GCG;   (b) the isolated, synthetic or recombinant nucleic acid of  claim 1 , wherein the modification comprises:   the nucleotides at positions 112 to 114 are TAT or TAC,   the nucleotides at positions 181 to 183 are CAA or CAG,   the nucleotides at positions 205 to 207 are GAA or GAG,   the nucleotides at positions 280 to 282 are CAA or CAG,   the nucleotides at positions 496 to 498 are GTT, GTC, GTA or GTG,   the nucleotides at positions 547 to 549 are CGT, CGC, CGA, CGG, AGA or AGG,   the nucleotides at positions 571 to 573 are GCT, GCC, GCA or GCG,   the nucleotides at positions 634 to 636 are CCA, CCC, CCG or CCT,   the nucleotides at positions 826 to 828 are GCT, GCC, GCA or GCG, and   the nucleotides at positions 838 to 840 are GGT, GGC, GGA or GGG;   (c) the isolated, synthetic or recombinant nucleic acid of  claim 1 , wherein the modification comprises:   the nucleotides at positions 112 to 114 are TAT or TAC,   the nucleotides at positions 181 to 183 are CAA or CAG,   the nucleotides at positions 205 to 207 are GAA or GAG,   the nucleotides at positions 280 to 282 are CAA or CAG,   the nucleotides at positions 496 to 498 are GTT, GTC, GTA or GTG,   the nucleotides at positions 547 to 549 are CGT, CGC, CGA, CGG, AGA or AGG,   the nucleotides at positions 571 to 573 are GCT, GCC, GCA or GCG,   the nucleotides at positions 634 to 636 are CCA, CCC, CCG or CCT,   the nucleotides at positions 826 to 828 are GCT, GCC, GCA or GCG,   the nucleotides at positions 838 to 840 are GGT, GGC, GGA or GGG, and   the nucleotides at positions 889 to 891 are CCA, CCC, CCG or CCT;   (d) the isolated, synthetic or recombinant nucleic acid of  claim 1 , wherein the modification comprises:   the nucleotides at positions 181 to 183 are CAA or CAG,   the nucleotides at positions 205 to 207 are GAA or GAG,   the nucleotides at positions 280 to 282 are CAA or CAG,   the nucleotides at positions 496 to 498 are GTT, GTC, GTA or GTG,   the nucleotides at positions 547 to 549 are CGT, CGC, CGA, CGG, AGA or AGG,   the nucleotides at positions 571 to 573 are GCT, GCC, GCA or GCG,   the nucleotides at positions 634 to 636 are CCA, CCC, CCG or CCT,   the nucleotides at positions 826 to 828 are GCT, GCC, GCA or GCG,   the nucleotides at positions 838 to 840 are GGT, GGC, GGA or GGG,   the nucleotides at positions 889 to 891 are CCA, CCC, CCG or CCT, and   the nucleotides at positions 901 to 903 are CAA or CAG;   (e) the isolated, synthetic or recombinant nucleic acid of  claim 1 , wherein the modification comprises:   the nucleotides at positions 181 to 183 are CAA or CAG,   the nucleotides at positions 205 to 207 are GAA or GAG,   the nucleotides at positions 211 to 213 are TCT, TCC, TCA, TCG, AGT or AGC,   the nucleotides at positions 280 to 282 are CAA or CAG,   the nucleotides at positions 496 to 498 are GTT, GTC, GTA or GTG,   the nucleotides at positions 547 to 549 are CGT, CGC, CGA, CGG, AGA or AGG,   the nucleotides at positions 571 to 573 are GCT, GCC, GCA or GCG,   the nucleotides at positions 634 to 636 are CCA, CCC, CCG or CCT,   the nucleotides at positions 826 to 828 are GCT, GCC, GCA or GCG,   the nucleotides at positions 838 to 840 are GGT, GGC, GGA or GGG,   the nucleotides at positions 889 to 891 are CCA, CCC, CCG or CCT, and   the nucleotides at positions 901 to 903 are CAA or CAG;   (f) the isolated, synthetic or recombinant nucleic acid of  claim 1 , wherein the modification comprises:   the nucleotides at positions 181 to 183 are CAA or CAG,   the nucleotides at positions 205 to 207 are GAA or GAG,   the nucleotides at positions 208 to 210 are CCA, CCC, CCG or CCT,   the nucleotides at positions 211 to 213 are TCT, TCC, TCA, TCG, AGT or AGC,   the nucleotides at positions 496 to 498 are GTT, GTC, GTA or GTG,   the nucleotides at positions 547 to 549 are CGT, CGC, CGA, CGG, AGA or AGG,   the nucleotides at positions 571 to 573 are GCT, GCC, GCA or GCG,   the nucleotides at positions 634 to 636 are CCA, CCC, CCG or CCT,   the nucleotides at positions 826 to 828 are GCT, GCC, GCA or GCG,   the nucleotides at positions 838 to 840 are GGT, GGC, GGA or GGG,   the nucleotides at positions 889 to 891 are CCA, CCC, CCG or CCT, and   the nucleotides at positions 901 to 903 are CAA or CAG; or   (g) the isolated, synthetic or recombinant nucleic acid of  claim 1 , wherein the modification comprises:   the nucleotides at positions 112 to 114 are TAT or TAC,   the nucleotides at positions 181 to 183 are CAA or CAG,   the nucleotides at positions 205 to 207 are GAA or GAG,   the nucleotides at positions 211 to 213 are TCT, TCC, TCA, TCG, AGT or AGC,   the nucleotides at positions 496 to 498 are GTT, GTC, GTA or GTG,   the nucleotides at positions 547 to 549 are CGT, CGC, CGA, CGG, AGA or AGG,   the nucleotides at positions 571 to 573 are GCT, GCC, GCA or GCG,   the nucleotides at positions 634 to 636 are CCA, CCC, CCG or CCT,   the nucleotides at positions 691 to 693 are ATT, ATC or ATA,   the nucleotides at positions 826 to 828 are GCT, GCC, GCA or GCG,   the nucleotides at positions 838 to 840 are GGT, GGC, GGA or GGG,   the nucleotides at positions 889 to 891 are CCA, CCC, CCG or CCT, and   the nucleotides at positions 901 to 903 are CAA or CAG.   
     
     
         3 . The isolated, synthetic or recombinant nucleic acid of  claim 2 , wherein the nucleic acid sequence encodes a polypeptide having the amino acid sequence:
 (a) of SEQ ID NO:2 and the amino acid sequence comprises at least one, two, three, four, five, six, seven, eight, nine, ten, eleven (11), twelve (12), 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 or 70 or more or all of the following amino acid residue changes to SEQ ID NO:2:   the glycine at amino acid position 2 is asparagine,   the glycine at amino acid position 13 is asparagine,   the phenylalanine at amino acid position 38 is tyrosine,   the serine at amino acid position 57 is aspartic acid,   the tyrosine at amino acid position 61 is glutamine,   the tyrosine at amino acid position 61 is serine,   the alanine at amino acid position 62 is threonine,   the phenylalanine at amino acid position 63 is histidine,   the phenylalanine at amino acid position 63 is threonine,   the methionine at amino acid position 69 is glutamic acid,   the methionine at amino acid position 69 is glutamine,   the methionine at amino acid position 69 is histidine,   the methionine at amino acid position 69 is serine,   the methionine at amino acid position 69 is tyrosine,   the aspartic acid at amino acid position 70 is proline,   the arginine at amino acid position 71 is alanine,   the arginine at amino acid position 71 is glutamic acid,   the arginine at amino acid position 71 is glutamine,   the arginine at amino acid position 71 is proline,   the arginine at amino acid position 71 is serine,   the arginine at amino acid position 71 is threonine,   the lysine at amino acid position 74 is glutamic acid,   the lysine at amino acid position 74 is leucine,   the lysine at amino acid position 74 is methionine,   the isoleucine at amino acid position 94 is glutamine,   the methionine at amino acid position 101 is tyrosine,   the aspartic acid at amino acid position 103 is cysteine,   the aspartic acid at amino acid position 103 is glutamine,   the glutamic acid at amino acid position 106 is glycine,   the glutamic acid at amino acid position 109 is leucine,   the lysine at amino acid position 116 is alanine,   the lysine at amino acid position 116 is arginine,   the phenylalanine at amino acid position 130 is tyrosine,   the phenylalanine at amino acid position 131 is leucine,   the glutamic acid at amino acid position 148 is histidine,   the lysine at amino acid position 162 is glutamine,   the isoleucine at amino acid position 166 is alanine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 183 is valine,   the lysine at amino acid position 186 is alanine,   the lysine at amino acid position 186 is aspartic acid,   the lysine at amino acid position 186 is proline,   the lysine at amino acid position 186 is serine,   the serine at amino acid position 191 is alanine,   the serine at amino acid position 191 is cysteine,   the serine at amino acid position 191 is leucine,   the phenylalanine at amino acid position 201 is isoleucine,   the phenylalanine at amino acid position 201 is proline,   the phenylalanine at amino acid position 201 is valine,   the glutamic acid at amino acid position 212 is proline,   the lysine at amino acid position 216 is alanine,   the histidine at amino acid position 230 is arginine,   the histidine at amino acid position 230 is glutamine,   the histidine at amino acid position 230 is lysine,   the leucine at amino acid position 231 is isoleucine,   the leucine at amino acid position 231 is methionine,   the leucine at amino acid position 231 is valine,   the glutamic acid at amino acid position 234 is aspartic acid,   the lysine at amino acid position 246 is glutamine,   the lysine at amino acid position 246 is serine,   the arginine at amino acid position 258 is serine,   the arginine at amino acid position 258 is tyrosine,   the leucine at amino acid position 262 is glutamine,   the leucine at amino acid position 262 is histidine,   the leucine at amino acid position 262 is methionine,   the leucine at amino acid position 262 is proline,   the serine at amino acid position 270 is arginine,   the phenylalanine at amino acid position 271 is alanine,   the methionine at amino acid position 276 is alanine,   the methionine at amino acid position 276 is cysteine,   the methionine at amino acid position 276 is serine,   the glutamic acid at amino acid position 277 is serine,   the arginine at amino acid position 280 is glycine,   the serine at amino acid position 290 is alanine,   the threonine at amino acid position 297 is alanine,   the threonine at amino acid position 297 is proline,   the leucine at amino acid position 298 is alanine,   the leucine at amino acid position 298 is arginine,   the leucine at amino acid position 298 is asparagine,   the leucine at amino acid position 298 is serine,   the leucine at amino acid position 298 is valine,   the lysine at amino acid position 300 is glycine,   the threonine at amino acid position 301 is glutamine,   the aspartic acid at amino acid position 305 is proline,   the glycine at amino acid position 312 is isoleucine, and/or   the serine at amino acid position 315 is isoleucine; or   (b) of the polypeptide of (a), having the sequence of SEQ ID NO:2 and consisting of least one, two, three, four, five, six, seven, eight, nine, ten, eleven (11), twelve (12), 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 or 70 or all of the following amino acid residue changes to SEQ ID NO:2:   the glycine at amino acid position 2 is asparagine,   the glycine at amino acid position 13 is asparagine,   the phenylalanine at amino acid position 38 is tyrosine,   the serine at amino acid position 57 is aspartic acid,   the tyrosine at amino acid position 61 is glutamine,   the tyrosine at amino acid position 61 is serine,   the alanine at amino acid position 62 is threonine,   the phenylalanine at amino acid position 63 is histidine,   the phenylalanine at amino acid position 63 is threonine,   the methionine at amino acid position 69 is glutamic acid,   the methionine at amino acid position 69 is glutamine,   the methionine at amino acid position 69 is histidine,   the methionine at amino acid position 69 is serine,   the methionine at amino acid position 69 is tyrosine,   the aspartic acid at amino acid position 70 is proline,   the arginine at amino acid position 71 is alanine,   the arginine at amino acid position 71 is glutamic acid,   the arginine at amino acid position 71 is glutamine,   the arginine at amino acid position 71 is proline,   the arginine at amino acid position 71 is serine,   the arginine at amino acid position 71 is threonine,   the lysine at amino acid position 74 is glutamic acid,   the lysine at amino acid position 74 is leucine,   the lysine at amino acid position 74 is methionine,   the isoleucine at amino acid position 94 is glutamine,   the methionine at amino acid position 101 is tyrosine,   the aspartic acid at amino acid position 103 is cysteine,   the aspartic acid at amino acid position 103 is glutamine,   the glutamic acid at amino acid position 106 is glycine,   the glutamic acid at amino acid position 109 is leucine,   the lysine at amino acid position 116 is alanine,   the lysine at amino acid position 116 is arginine,   the phenylalanine at amino acid position 130 is tyrosine,   the phenylalanine at amino acid position 131 is leucine,   the glutamic acid at amino acid position 148 is histidine,   the lysine at amino acid position 162 is glutamine,   the isoleucine at amino acid position 166 is alanine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 183 is valine,   the lysine at amino acid position 186 is alanine,   the lysine at amino acid position 186 is aspartic acid,   the lysine at amino acid position 186 is proline,   the lysine at amino acid position 186 is serine,   the serine at amino acid position 191 is alanine,   the serine at amino acid position 191 is cysteine,   the serine at amino acid position 191 is leucine,   the phenylalanine at amino acid position 201 is isoleucine,   the phenylalanine at amino acid position 201 is proline,   the phenylalanine at amino acid position 201 is valine,   the glutamic acid at amino acid position 212 is proline,   the lysine at amino acid position 216 is alanine,   the histidine at amino acid position 230 is arginine,   the histidine at amino acid position 230 is glutamine,   the histidine at amino acid position 230 is lysine,   the leucine at amino acid position 231 is isoleucine,   the leucine at amino acid position 231 is methionine,   the leucine at amino acid position 231 is valine,   the glutamic acid at amino acid position 234 is aspartic acid,   the lysine at amino acid position 246 is glutamine,   the lysine at amino acid position 246 is serine,   the arginine at amino acid position 258 is serine,   the arginine at amino acid position 258 is tyrosine,   the leucine at amino acid position 262 is glutamine,   the leucine at amino acid position 262 is histidine,   the leucine at amino acid position 262 is methionine,   the leucine at amino acid position 262 is proline,   the serine at amino acid position 270 is arginine,   the phenylalanine at amino acid position 271 is alanine,   the methionine at amino acid position 276 is alanine,   the methionine at amino acid position 276 is cysteine,   the methionine at amino acid position 276 is serine,   the glutamic acid at amino acid position 277 is serine,   the arginine at amino acid position 280 is glycine,   the serine at amino acid position 290 is alanine,   the threonine at amino acid position 297 is alanine,   the threonine at amino acid position 297 is proline,   the leucine at amino acid position 298 is alanine,   the leucine at amino acid position 298 is arginine,   the leucine at amino acid position 298 is asparagine,   the leucine at amino acid position 298 is serine,   the leucine at amino acid position 298 is valine,   the lysine at amino acid position 300 is glycine,   the threonine at amino acid position 301 is glutamine,   the aspartic acid at amino acid position 305 is proline,   the glycine at amino acid position 312 is isoleucine, and/or   the serine at amino acid position 315 is isoleucine.   
     
     
         4 . An expression cassette, a vector or a cloning vehicle comprising (a) the nucleic acid sequence of  claim 1 ; (b) the expression cassette, vector or cloning vehicle of (a) comprising, or inserted into, a viral vector, a plasmid, a phage, a phagemid, a cosmid, a fosmid, a bacteriophage or an artificial chromosome; (c) the expression cassette, vector or cloning vehicle of (b), wherein the viral vector comprises an adenovirus vector, a retroviral vector or an adeno-associated viral vector; or (d) the expression cassette, vector or cloning vehicle of (a), (b) or (c), comprising, or inserted into, a bacterial artificial chromosome (BAC), a plasmid, a bacteriophage P1-derived vector (PAC), a yeast artificial chromosome (YAC), or a mammalian artificial chromosome (MAC). 
     
     
         5 . A transformed cell comprising the expression cassette, a vector or a cloning vehicle of  claim 4 ; wherein the transformed cell is a bacterial cell, a mammalian cell, a fungal cell, a yeast cell, an insect cell or a plant cell; or wherein the bacterial cell is any species within the genera  Escherichia, Bacillus, Streptomyces, Salmonella, Pseudomonas  or  Staphylococcus , or  Escherichia coli, Lactococcus lactis, Bacillus subtilis, Bacillus cereus, Salmonella typhimurium  or  Pseudomonas fluorescens.    
     
     
         6 . A transgenic plant or seed comprising the sequence of  claim 1 , wherein the plant is a corn plant, a sorghum plant, a potato plant, a tomato plant, a wheat plant, an oilseed plant, a rapeseed plant, a soybean plant, a rice plant, a barley plant, a grass, a tobacco plant; or a forage and/or feed plant for an animal, or a ruminants, and optionally the forage or feed plant is hay, corn, millet, soy, wheat, buckwheat, barley, alfalfa, rye, an annual grass, sorghum, sudangrass, veldt grass or buffel grass or wherein the seed is a corn seed, a wheat kernel, an oilseed, a rapeseed, a soybean seed, a palm kernel, a sunflower seed, a sesame seed, a rice, a barley, a peanut or a tobacco plant seed; or a seed from any forage and/or feed plant for an animal or a ruminant, and optionally the forage or feed plant is hay, corn, millet, soy, wheat, buckwheat, barley, alfalfa, rye, an annual grass, sorghum, sudangrass, veldt grass or buffel grass. 
     
     
         7 . An isolated, synthetic or recombinant polypeptide comprising:
 (a) (i) an amino acid sequence encoded by a nucleic acid comprising the nucleic acid sequence of  claim 1 , or (ii) having an amino acid sequence as set forth in SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:19, SEQ ID NO:21, and/or SEQ ID NO:23, and comprising, or consisting of, at least one, two, three, four, five, six, seven, eight, nine, ten, eleven (11), twelve (12), 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 or 70 or all of the following amino acid residue changes to SEQ ID NO:2:   the glycine at amino acid position 2 is asparagine,   the glycine at amino acid position 13 is asparagine,   the phenylalanine at amino acid position 38 is tyrosine,   the serine at amino acid position 57 is aspartic acid,   the tyrosine at amino acid position 61 is glutamine,   the tyrosine at amino acid position 61 is serine,   the alanine at amino acid position 62 is threonine,   the phenylalanine at amino acid position 63 is histidine,   the phenylalanine at amino acid position 63 is threonine,   the methionine at amino acid position 69 is glutamic acid,   the methionine at amino acid position 69 is glutamine,   the methionine at amino acid position 69 is histidine,   the methionine at amino acid position 69 is serine,   the methionine at amino acid position 69 is tyrosine,   the aspartic acid at amino acid position 70 is proline,   the arginine at amino acid position 71 is alanine,   the arginine at amino acid position 71 is glutamic acid,   the arginine at amino acid position 71 is glutamine,   the arginine at amino acid position 71 is proline,   the arginine at amino acid position 71 is serine,   the arginine at amino acid position 71 is threonine,   the lysine at amino acid position 74 is glutamic acid,   the lysine at amino acid position 74 is leucine,   the lysine at amino acid position 74 is methionine,   the isoleucine at amino acid position 94 is glutamine,   the methionine at amino acid position 101 is tyrosine,   the aspartic acid at amino acid position 103 is cysteine,   the aspartic acid at amino acid position 103 is glutamine,   the glutamic acid at amino acid position 106 is glycine,   the glutamic acid at amino acid position 109 is leucine,   the lysine at amino acid position 116 is alanine,   the lysine at amino acid position 116 is arginine,   the phenylalanine at amino acid position 130 is tyrosine,   the phenylalanine at amino acid position 131 is leucine,   the glutamic acid at amino acid position 148 is histidine,   the lysine at amino acid position 162 is glutamine,   the isoleucine at amino acid position 166 is alanine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 183 is valine,   the lysine at amino acid position 186 is alanine,   the lysine at amino acid position 186 is aspartic acid,   the lysine at amino acid position 186 is proline,   the lysine at amino acid position 186 is serine,   the serine at amino acid position 191 is alanine,   the serine at amino acid position 191 is cysteine,   the serine at amino acid position 191 is leucine,   the phenylalanine at amino acid position 201 is isoleucine,   the phenylalanine at amino acid position 201 is proline,   the phenylalanine at amino acid position 201 is valine,   the glutamic acid at amino acid position 212 is proline,   the lysine at amino acid position 216 is alanine,   the histidine at amino acid position 230 is arginine,   the histidine at amino acid position 230 is glutamine,   the histidine at amino acid position 230 is lysine,   the leucine at amino acid position 231 is isoleucine,   the leucine at amino acid position 231 is methionine,   the leucine at amino acid position 231 is valine,   the glutamic acid at amino acid position 234 is aspartic acid,   the lysine at amino acid position 246 is glutamine,   the lysine at amino acid position 246 is serine,   the arginine at amino acid position 258 is serine,   the arginine at amino acid position 258 is tyrosine,   the leucine at amino acid position 262 is glutamine,   the leucine at amino acid position 262 is histidine,   the leucine at amino acid position 262 is methionine,   the leucine at amino acid position 262 is proline,   the serine at amino acid position 270 is arginine,   the phenylalanine at amino acid position 271 is alanine,   the methionine at amino acid position 276 is alanine,   the methionine at amino acid position 276 is cysteine,   the methionine at amino acid position 276 is serine,   the glutamic acid at amino acid position 277 is serine,   the arginine at amino acid position 280 is glycine,   the serine at amino acid position 290 is alanine,   the threonine at amino acid position 297 is alanine,   the threonine at amino acid position 297 is proline,   the leucine at amino acid position 298 is alanine,   the leucine at amino acid position 298 is arginine,   the leucine at amino acid position 298 is asparagine,   the leucine at amino acid position 298 is serine,   the leucine at amino acid position 298 is valine,   the lysine at amino acid position 300 is glycine,   the threonine at amino acid position 301 is glutamine,   the aspartic acid at amino acid position 305 is proline,   the glycine at amino acid position 312 is isoleucine, and/or   the serine at amino acid position 315 is isoleucine;   (b) the polypeptide of (a), comprising the amino acid sequence of SEQ ID NO:7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO:13, SEQ ID NO:19, SEQ ID NO:21 or SEQ ID NO:23;   (c) the polypeptide of (a) or (b) having a glucanase activity but lacking: a signal sequence or proprotein sequence;   (d) the polypeptide of (a), (b), or (c) having a glucanase activity and further comprising a heterologous sequence;   (e) the polypeptide of (d), wherein the heterologous amino acid sequence comprises, or consists of a heterologous (leader) signal sequence, or a tag or an epitope;   (f) the polypeptide of (d) or (e), wherein the heterologous (leader) signal sequence comprises or consists of an N-terminal and/or C-terminal extension for targeting to an endoplasmic reticulum (ER) or endomembrane, or to a maize endoplasmic reticulum (ER) or endomembrane system, or the heterologous amino acid sequence comprises, or consists of an enzyme target site;   (g) the polypeptide of any of (a) to (f), wherein the glucanase activity comprises: an endoglucanase activity; catalyzing hydrolysis of 1,4-beta-D-glycosidic linkages or internal β-1,3-glucosidic linkages, hydrolyzing a glucan, a mannan, an arabinoxylan or a xylan, to produce a smaller molecular weight polysaccharide or oligomer; an endo-1,4-beta-endoglucanase activity; a 1,4-beta-D-glycosidic linkage activity comprising hydrolysis of a 1,4-beta-D-glycosidic linkage in a cellulose, a cellulose derivative, a lichenin or a cereal, or a cellulose derivative comprising a carboxy methyl cellulose or a hydroxy ethyl cellulose, or a cereal comprising a beta-D-glucan or a xyloglucan; hydrolyzing polysaccharides comprising 1,4-β-glycoside-linked D-glucopyranoses; hydrolyzing a cellulose, a cellulose derivative or a hemicellulose; hydrolyzing a cellulose or a hemicellulose in a wood or paper pulp or a wood or paper product; catalyzing hydrolysis of glucan in a feed, a food product or a beverage, or a feed, food product or beverage comprising a cereal-based animal feed, a wort or a beer, a dough, a fruit or a vegetable; catalyzing hydrolysis of a glucan, a mannan, an arabinoxylan or a xylan, in a microbial cell, a fungal cell, a mammalian cell or a plant cell;   (h) the polypeptide of any of (a) to (g), wherein (i) the polypeptide is glycosylated, or the polypeptide comprises at least one glycosylation site, (ii) the polypeptide of (i) wherein the glycosylation is an N-linked glycosylation or an O-linked glycosylation; (iii) the polypeptide of (i) or (ii) wherein the polypeptide is glycosylated after being expressed in a yeast cell; or (iv) the polypeptide of (iii) wherein the yeast cell is a  P. pastoris  or a  S. pombe ; or   (i) the polypeptide of any one of (a) to (h), wherein (i) the polypeptide further comprises additional amino acid residues between a signal sequence (leader sequence or leader peptide) and the enzyme, or (ii) the polypeptide of (i), wherein the additional amino acid residues comprise Glu-Ala.   
     
     
         8 . The isolated, synthetic or recombinant polypeptide of  claim 7 , wherein
 (a) the polypeptide of  claim 7 , wherein the amino acid residue changes (the modification) to SEQ ID NO:2 comprises:   the phenylalanine at amino acid position 38 is tyrosine,   the tyrosine at amino acid position 61 is glutamine,   the methionine at amino acid position 69 is glutamic acid,   the isoleucine at amino acid position 94 is glutamine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 191 is alanine, and   the methionine at amino acid position 276 is alanine;   (b) the polypeptide of  claim 7 , wherein the amino acid residue changes (the modification) to SEQ ID NO:2 comprises:   the phenylalanine at amino acid position 38 is tyrosine,   the tyrosine at amino acid position 61 is glutamine,   the methionine at amino acid position 69 is glutamic acid,   the isoleucine at amino acid position 94 is glutamine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 191 is alanine,   the glutamic acid at amino acid position 212 is proline,   the methionine at amino acid position 276 is alanine, and   the arginine at amino acid position 280 is glycine;   (c) the polypeptide of  claim 7 , wherein the amino acid residue changes (the modification) to SEQ ID NO:2 comprises:   the phenylalanine at amino acid position 38 is tyrosine,   the tyrosine at amino acid position 61 is glutamine,   the methionine at amino acid position 69 is glutamic acid,   the isoleucine at amino acid position 94 is glutamine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 191 is alanine,   the glutamic acid at amino acid position 212 is proline,   the methionine at amino acid position 276 is alanine,   the arginine at amino acid position 280 is glycine, and   the threonine at amino acid position 297 is proline;   (d) the polypeptide of  claim 7 , wherein the amino acid residue changes (the modification) to SEQ ID NO:2 comprises:   the tyrosine at amino acid position 61 is glutamine,   the methionine at amino acid position 69 is glutamic acid,   the isoleucine at amino acid position 94 is glutamine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 191 is alanine,   the glutamic acid at amino acid position 212 is proline,   the methionine at amino acid position 276 is alanine,   the arginine at amino acid position 280 is glycine,   the threonine at amino acid position 297 is proline, and   the threonine at amino acid position 301 is glutamine;   (e) the polypeptide of  claim 7 , wherein the amino acid residue changes (the modification) to SEQ ID NO:2 comprises:   the tyrosine at amino acid position 61 is glutamine,   the methionine at amino acid position 69 is glutamic acid,   the arginine at amino acid position 71 is serine,   the isoleucine at amino acid position 94 is glutamine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 191 is alanine,   the glutamic acid at amino acid position 212 is proline,   the methionine at amino acid position 276 is alanine,   the arginine at amino acid position 280 is glycine,   the threonine at amino acid position 297 is proline, and   the threonine at amino acid position 301 is glutamine;   (f) the polypeptide of  claim 7 , wherein the amino acid residue changes (the modification) to SEQ ID NO:2 comprises:   the tyrosine at amino acid position 61 is glutamine,   the methionine at amino acid position 69 is glutamic acid,   the aspartic acid at amino acid position 70 is proline,   the arginine at amino acid position 71 is serine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 191 is alanine,   the glutamic acid at amino acid position 212 is proline,   the methionine at amino acid position 276 is alanine,   the arginine at amino acid position 280 is glycine,   the threonine at amino acid position 297 is proline, and   the threonine at amino acid position 301 is glutamine; or   (g) the polypeptide of  claim 7 , wherein the amino acid residue changes (the modification) to SEQ ID NO:2 comprises:   the phenylalanine at amino acid position 38 is tyrosine,   the tyrosine at amino acid position 61 is glutamine,   the methionine at amino acid position 69 is glutamic acid,   the arginine at amino acid position 71 is serine,   the isoleucine at amino acid position 166 is valine,   the serine at amino acid position 183 is arginine,   the serine at amino acid position 191 is alanine,   the glutamic acid at amino acid position 212 is proline,   the leucine at amino acid position 231 is valine,   the methionine at amino acid position 276 is alanine,   the arginine at amino acid position 280 is glycine,   the threonine at amino acid position 297 is proline, and   the threonine at amino acid position 301 is glutamine.   
     
     
         9 . A heterodimer or a homodimer comprising the polypeptide of  claim 7 . 
     
     
         10 . An immobilized polypeptide: (a) wherein the polypeptide comprises the polypeptide of  claim 7 , or a subsequence thereof; or (b) the immobilized polypeptide of (a), wherein the polypeptide is immobilized on a cell, a metal, a resin, a polymer, a ceramic, a glass, a microelectrode, a graphitic particle, a bead, a gel, a plate, an array or a capillary tube. 
     
     
         11 . A method of producing a recombinant polypeptide comprising:
 (i) (a) providing the nucleic acid of  claim 1 ; and (b) expressing the nucleic acid of step (a) under conditions that allow expression of the polypeptide, thereby producing a recombinant polypeptide; or   (ii) the method of (i), further comprising transforming a host cell with the nucleic acid of step (i) (a) followed by expressing the nucleic acid of step (a), thereby producing a recombinant polypeptide in a transformed cell.   
     
     
         12 . A method of generating a variant of a nucleic acid encoding a polypeptide with a glucanase activity comprising:
 (i) (a) providing a template nucleic acid comprising the nucleic acid sequence of  claim 1 ; and
 (b) modifying, deleting or adding one or more nucleotides in the template sequence, or a combination thereof, to generate a variant of the template nucleic acid. 
   wherein optionally the method further comprises expressing the variant nucleic acid to generate a variant glucanase polypeptide;   (ii) the method of (i), wherein the modifications, additions or deletions are introduced by a method comprising error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, ensemble mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, Gene Site Saturation Mutagenesis (GSSM), synthetic ligation reassembly (SLR), recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, artificial gene synthesis, chimeric nucleic acid multimer creation, or a combination thereof;   (iii) the method of (i) or (ii), wherein the method is iteratively repeated until a variant glucanase polypeptide having an altered or different activity or an altered or different stability from that of a polypeptide encoded by the template nucleic acid is produced;   (iv) the method of (iii), wherein the variant glucanase polypeptide is thermotolerant, and retains some activity after being exposed to an elevated temperature, or the variant glucanase polypeptide has increased glycosylation as compared to the glucanase encoded by a template nucleic acid, or the variant glucanase polypeptide has a glucanase activity under a high temperature, wherein the glucanase encoded by the template nucleic acid is not active under the high temperature;   (v) the method of (iii), wherein the method is iteratively repeated until a glucanase coding sequence having an altered codon usage from that of the template nucleic acid is produced; or   (vi) the method of (iii), wherein the method is iteratively repeated until a glucanase gene having higher or lower level of message expression or stability from that of the template nucleic acid is produced.   
     
     
         13 . A method for modifying codons in a nucleic acid encoding a glucanase polypeptide, the method comprising:
 (a) providing a nucleic acid encoding a polypeptide with a glucanase activity comprising the nucleic acid sequence of  claim 1 ; and,   (b) identifying a codon in the nucleic acid of step (a) and replacing it with a different codon encoding the same amino acid as the replaced codon, thereby modifying codons in a nucleic acid encoding a glucanase.   
     
     
         14 . A method of increasing thermotolerance or thermostability of a glucanase polypeptide, the method comprising glycosylating a glucanase, xylanase and/or a mannanase, wherein the polypeptide comprises the polypeptide of  claim 7 , thereby increasing the thermotolerance or thermostability of the glucanase, xylanase and/or a mannanase. 
     
     
         15 . A method for overexpressing a recombinant glucanase, xylanase and/or a mannanase in a cell comprising expressing a vector comprising the nucleic acid sequence of  claim 1 , wherein overexpression is effected by use of a high activity promoter, a dicistronic vector or by gene amplification of the vector. 
     
     
         16 . A method of making a transgenic plant comprising:
 (i) (a) introducing a heterologous nucleic acid sequence into the cell, wherein the heterologous nucleic sequence comprises the nucleic acid sequence of  claim 1 , thereby producing a transformed plant cell; and
 (b) producing a transgenic plant from the transformed cell; 
   (ii) the method of (i), wherein the step (a) further comprises introducing the heterologous nucleic acid sequence by DNA particle bombardment, electroporation or microinjection of plant cell protoplasts; or   (iii) the method of (i), wherein the step (a) comprises introducing the heterologous nucleic acid sequence directly to plant tissue by DNA particle bombardment or by using an  Agrobacterium tumefaciens  host.   
     
     
         17 . A method of expressing a heterologous nucleic acid sequence in a plant cell comprising the following steps:
 (a) transforming the plant cell with a heterologous nucleic acid sequence operably linked to a promoter, wherein the heterologous nucleic sequence comprises the nucleic acid sequence of  claim 1 ;   (b) growing the plant under conditions wherein the heterologous nucleic acids sequence is expressed in the plant cell.   
     
     
         18 . A method for hydrolyzing, breaking up or disrupting a glucan-, xylan- and/or mannan-comprising composition comprising the following steps:
 (a) providing the polypeptide having a glucanase, xylanase and/or a mannanase activity of  claim 7 ;   (b) providing a composition comprising a glucan, xylan and/or mannan; and   (c) contacting the polypeptide of step (a) with the composition of step (b) under conditions wherein the glucanase, xylanase and/or a mannanase hydrolyzes, breaks up or disrupts the glucan-, xylan- or mannan-comprising composition,   wherein optionally the composition comprises a plant cell, a bacterial cell, a yeast cell, an insect cell, a fungal cell or an animal cell.   
     
     
         19 . A method for utilizing a glucanase, xylanase and/or a mannanase as a nutritional supplement or a dietary supplement in a human or an animal diet, the method comprising:
 (i) preparing a nutritional or dietary supplement containing a glucanase, xylanase and/or a mannanase enzyme comprising the polypeptide of  claim 7 ; and   administering the nutritional or dietary supplement to the human or animal to increase utilization of a xylan contained in a food or feed ingested by the human or animal;   (ii) the method of (i), wherein the animal is a ruminant or a monogastric animal;   (iii) the method of (i) or (ii), wherein the glucanase, xylanase and/or a mannanase enzyme is prepared by expression of a polynucleotide encoding the glucanase, xylanase and/or a mannanase in an organism selected from the group consisting of a bacterium, a yeast, a plant, an insect, a fungus and an animal;   (iv) the method of (iii), wherein the organism is selected from the group consisting of an  Pseudomonas fluorescens, S. pombe, S. cerevisiae, Pichia pastoris, E. coli, Streptomyces  sp.,  Bacillus  sp. and  Lactobacillus  sp.; or   (v) the method of any of (i) to (iv), wherein the animal is a domestic animal, or a monogastric animal.   
     
     
         20 . A method for delivering a glucanase, xylanase and/or a mannanase supplement to a human or an animal, the method comprising:
 (i) (a) preparing an edible enzyme delivery matrix in the form of pellets comprising a granulate edible carrier and a thermostable recombinant glucanase, xylanase and/or a mannanase enzyme, wherein the pellets readily disperse the glucanase, xylanase and/or a mannanase enzyme contained therein into aqueous media, and
 (b) administering the edible enzyme delivery matrix to the human or animal; 
   (ii) the method of (i), wherein the recombinant glucanase, xylanase and/or a mannanase enzyme comprises the polypeptide of  claim 7 ;   (iii) the method of (i) or (ii), wherein the granulate edible carrier comprises a carrier selected from the group consisting of a grain germ, a grain germ that is spent of oil, a hay, an alfalfa, a timothy, a soy hull, a sunflower seed meal and a wheat midd;   (iv) the method of any of (i) to (iii), wherein the edible carrier comprises grain germ that is spent of oil;   (v) the method of any of (i) to (iv), wherein the delivery matrix is formed by pelletizing a mixture comprising a grain germ and a glucanase, xylanase and/or a mannanase;   (vi) the method of any of (i) to (v), wherein the glucanase, xylanase and/or a mannanase enzyme is glycosylated to provide thermostability at pelletizing conditions; or   (vii) the method of any of (vi), wherein the pelletizing conditions include application of steam, or the pelletizing conditions comprise application of a temperature in excess of about 80° C. for about 5 minutes and the enzyme retains a specific activity of at least 350 to about 900 units per milligram of enzyme.   
     
     
         21 . A method for reducing lignin in a paper, a wood or wood product comprising contacting the paper, wood or wood product with the polypeptide of  claim 7 . 
     
     
         22 . A fuel comprising the polypeptide of  claim 7 . 
     
     
         23 . A method for making a fuel comprising contacting a biomass with the polypeptide of  claim 7  wherein optionally the method comprises:
 (A) contacting a composition comprising a cellooligsaccharide, an arabinoxylan oligomer, a lignin, a lignocellulose, a xylan, a glucan, a cellulose or a fermentable sugar with the polypeptide of  claim 7 , 
 (B) the method of (A), wherein the composition comprising the cellooligsaccharide, arabinoxylan oligomer, lignin, lignocellulose, xylan, glucan, cellulose or fermentable sugar comprises a plant, plant product or plant derivative; 
 (C) the method of (A) or (B), wherein the plant or plant product comprises cane sugar plants or plant products, beets or sugarbeets, wheat, corn, soybeans, potato, rice or barley; 
 (D) the method of (C), wherein the plant is a monocot or dicot, or the plant is a monocot corn, sugarcane, rice, wheat, barley, switchgrass or  Miscanthus ; or the plant is a dicot oilseed crop, soy, canola, rapeseed, flax, cotton, palm oil, sugar beet, peanut, tree, poplar or lupine; 
 (E) the method of (A), (B), (C) or (D), wherein the polypeptide has activity comprising cellulase, endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, β-xylosidase and/or arabinofuranosidase activity, wherein optionally the composition further comprises a glucose oxidase, a glucose oxidase-1 (a β-glucosidase) or a glucose oxidase-2 (a β-xylosidase), 
 (F) the method of (A), (B), (C), (D) or (E), wherein the fuel comprises a liquid and/or a gas, or the fuel comprises a biofuel and/or a synthetic fuel, or the fuel comprises bioethanol, biomethanol, biopropanol and/or, bio-butanol; and/or a gasoline-ethanol, -methanol, -butanol and/or -propanol mix. 
 
     
     
         24 . A method for making bioethanol, biomethanol, biopropanol and/or, bio-butanol comprising:
 (A) contacting a composition comprising a cellooligsaccharide, an arabinoxylan oligomer, a lignin, a lignocellulose, a xylan, a glucan, a cellulose or a fermentable sugar with the polypeptide of  claim 7 ;   (B) the method of (A), wherein the composition of comprises a plant, plant product or plant derivative, and optionally the plant or plant product comprises cane sugar plants or plant products, beets or sugarbeets, wheat, corn, soybeans, potato, rice or barley;   (C) the method of (A) or (B), wherein the polypeptide has activity comprising lignocellulosic enzyme and/or cellulase, endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, β-xylosidase and/or arabinofuranosidase activity, wherein optionally the composition further comprises a glucose oxidase, a glucose oxidase-1 (a β-glucosidase) or a glucose oxidase-2 (a β-xylosidase);   (D) the method of (A), (B) or (C), wherein the plant is a monocot or dicot, or the plant is a monocot corn, sugarcane, rice, wheat, barley, switchgrass or  Miscanthus ; or the plant is a dicot oilseed crop, soy, canola, rapeseed, flax, cotton, palm oil, sugar beet, peanut, tree, poplar or lupine; or   (E) the method of (A), (B), (C) or (D), further comprising processing and/or formulating the bioethanol, biomethanol, biopropanol and/or, bio-butanol as a liquid fuel and/or a gas fuel, wherein optionally the fuel comprises a biofuel and/or a synthetic fuel, or the fuel comprises bioethanol, biomethanol, biopropanol and/or, bio-butanol; and/or a gasoline-ethanol, -methanol, -butanol and/or -propanol mix.   
     
     
         25 . A method for processing a biomass material comprising contacting a biomass material with the polypeptide of  claim 7 ,
 wherein optionally the biomass material comprising lignocellulose is derived from an agricultural crop, is a byproduct of a food or a feed production, is a lignocellulosic waste product, or is a plant residue or a waste paper or waste paper product, and optionally the polypeptide has activity comprising lignocellulosic enzyme and/or cellulase, endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, β-xylosidase and/or arabinofuranosidase activity, wherein optionally the composition further comprises a glucose oxidase, a glucose oxidase-1 (a β-glucosidase) or a glucose oxidase-2 (a β-xylosidase),   and optionally the plant residue comprise stems, leaves, hulls, husks, corn or corn cobs, corn stover, hay, straw, wood, wood chips, wood pulp, wood waste and sawdust,   and optionally the paper waste comprises discarded or used photocopy paper, computer printer paper, notebook paper, notepad paper, typewriter paper, newspapers, magazines, cardboard and paper-based packaging materials,   and optionally the processing of the biomass material generates a bioalcohol, a bioethanol, biomethanol, biobutanol or biopropanol.   
     
     
         26 . A drilling or oil and gas well washing and/or fracturing method comprising:
 (I) (a) providing a mixture of polymer-degrading (“polymer breaking”) enzymes, wherein at least one of the enzymes is a polymer-degrading (“polymer breaking”) enzyme, and optionally the polymer-degrading (“polymer breaking”) enzyme is a lignin degrading enzyme, a lignin peroxidase, a polysaccharide-degrading (“polymer breaking”) enzyme, a protein-degrading enzyme, an amylase, a xanthanase, a glucanase, a protease, a glycosidase and/or a cellulase; and
 (b) adding the polymer-degrading (“polymer breaking”) mixture of enzymes to a drilling fluid that is used during an oil and gas well drilling operation, or adding the mixture of enzymes to a drilling fluid that is used for an oil and gas well washing and/or fracturing operation, or 
   wherein optionally the polymer-degrading (“polymer breaking”) enzymes comprise:   (a) the polypeptide of  claim 7 ;   (b) a polypeptide having a sequence of SEQ ID NO:15 or SEQ ID NO:17; or   (c) a polypeptide having an amino acid sequence of (a) or (b), and retaining enzyme activity and comprising at least one amino acid residue conservative substitution,   wherein optionally conservative substitution comprises replacement of an aliphatic amino acid with another aliphatic amino acid; replacement of a serine with a threonine or vice versa; replacement of an acidic residue with another acidic residue; replacement of a residue bearing an amide group with another residue bearing an amide group; exchange of a basic residue with another basic residue; or, replacement of an aromatic residue with another aromatic residue, or a combination thereof,   and optionally the aliphatic residue comprises Alanine, Valine, Leucine, Isoleucine or a synthetic equivalent thereof; the acidic residue comprises Aspartic acid, Glutamic acid or a synthetic equivalent thereof; the residue comprising an amide group comprises Aspartic acid, Glutamic acid or a synthetic equivalent thereof; the basic residue comprises Lysine, Arginine or a synthetic equivalent thereof; or, the aromatic residue comprises Phenylalanine, Tyrosine or a synthetic equivalent thereof, or   (II) the method of (I), wherein optionally the enzyme is added as a fluid, wherein optionally the fluid comprises starch as a viscosifier,   wherein optionally the enzyme is formulated at relatively high alkalinity, wherein optionally the relatively high alkalinity is pH 9 to pH 9.5,   wherein optionally the enzyme is an acidic-to-neutral enzyme,   wherein optionally the enzyme remains dormant in the drilling fluid or oil and gas well washing and/or fracturing fluid, and in the mud cake (“filter cake”) that is formed after the loss of water from the fluid onto the formation surface,   wherein optionally in order to activate the enzyme, the mud cake can be washed with an acid solution, wherein the acid will neutralize the alkalinity of the mud cake (“filter cake”) and will provide an acidic environment which will trigger the enzyme activity and hydrolytic function toward starch or other polymers,   wherein optionally the enzyme is subjected to an “acid wash”, wherein optionally the acid wash is applied during the well drilling operations and/or the well cleaning operations in order to remove calcium carbonate deposits from the formation, or   wherein optionally the enzyme, once activated by the acid environment, will degrade the starch or other polymers and will remove the mud cake (“filter cake”) from the well bore.   
     
     
         27 . A method for degrading a xanthan, a guar, a hydroxyalkyl guar, a carboxyalkyl guar, a guar gum, a guar gum powder, a lignified coat of guar seeds or a solidified guar gum, comprising
 (I) (a) providing at least one enzyme or a mixture of polymer-degrading (“polymer breaking”) enzymes, wherein at least one of the enzymes is a polymer-degrading (“polymer breaking”) enzyme, and optionally the polymer-degrading (“polymer breaking”) enzyme is a lignin degrading enzyme, a lignin peroxidase, a polysaccharide-degrading enzyme, a protein-degrading enzyme, an amylase, a xanthanase, a glucanase, a protease, a glycosidase and/or a cellulase; and
 (b) adding the polymer-degrading (“polymer breaking”) enzyme or mixture of enzymes to the guar, hydroxyalkyl guar, carboxyalkyl guar, guar gum, guar gum powder, lignified coat of guar seeds or solidified guar gum in an amount sufficient to degrade the guar, hydroxyalkyl guar, carboxyalkyl guar, guar gum, guar gum powder, lignified coat of guar seeds or solidified guar gum, 
   wherein optionally the polymer-degrading (“polymer breaking”) enzyme or mixture of enzymes comprise:   (a) the polypeptide of  claim 7 ;   (b) a polypeptide having a sequence of SEQ ID NO:15 or SEQ ID NO:17; or   (c) a polypeptide having an amino acid sequence of (a) or (b), and retaining enzyme activity and comprising at least one amino acid residue conservative substitution,   wherein optionally conservative substitution comprises replacement of an aliphatic amino acid with another aliphatic amino acid; replacement of a serine with a threonine or vice versa; replacement of an acidic residue with another acidic residue; replacement of a residue bearing an amide group with another residue bearing an amide group; exchange of a basic residue with another basic residue; or, replacement of an aromatic residue with another aromatic residue, or a combination thereof,   and optionally the aliphatic residue comprises Alanine, Valine, Leucine, Isoleucine or a synthetic equivalent thereof; the acidic residue comprises Aspartic acid, Glutamic acid or a synthetic equivalent thereof; the residue comprising an amide group comprises Aspartic acid, Glutamic acid or a synthetic equivalent thereof; the basic residue comprises Lysine, Arginine or a synthetic equivalent thereof; or, the aromatic residue comprises Phenylalanine, Tyrosine or a synthetic equivalent thereof, or   (II) the method of (I), wherein optionally the enzyme is added as a fluid, wherein optionally the fluid comprises starch as a viscosifier,   wherein optionally the enzyme is formulated at relatively high alkalinity, wherein optionally the relatively high alkalinity is pH 9 to pH 9.5,   wherein optionally the enzyme is an acidic-to-neutral enzyme,   wherein optionally the enzyme remains dormant in the drilling fluid or oil and gas well washing and/or fracturing fluid, and in the mud cake (“filter cake”) that is formed after the loss of water from the fluid onto the formation surface,   wherein optionally in order to activate the enzyme, the mud cake can be washed with an acid solution, wherein the acid will neutralize the alkalinity of the mud cake (“filter cake”) and will provide an acidic environment which will trigger the enzyme activity and hydrolytic function toward starch or other polymers,   wherein optionally the enzyme is subjected to an “acid wash”, wherein optionally the acid wash is applied during the well drilling operations and/or the well cleaning operations in order to remove calcium carbonate deposits from the formation, or   wherein optionally the enzyme, once activated by the acid environment, will degrade the starch or other polymers and will remove the mud cake (“filter cake”) from the well bore.   
     
     
         28 . The method of  claim 27 , wherein the mixture of enzymes comprises at least one, two, three, four, five, six, seven, eight, nine or ten or all of the enzymes selected from the group consisting of a lignin degrading enzyme, alpha amylase, beta amylase, glucoamylase, dextrinase, cellulase, cellobiohydrolase, avicelase, carboxymethylcellulase, beta-glucanase, glucosidase, xylanase, mannanase, arabinofuranosidase, laccase, lignin peroxidase, pectinase, pectate lyase, xanthanase, xanthan lyase, xanthan depolymerase, pullulanase, lichenase, pachymanase, lipase, protease, proteinase, phytase, peptidase and catalase; or amylases, xanthanases, glycosidases, cellulases) the use of any combination of other enzymes such as tryptophanases or tyrosine decarboxylases, laccases, catalases, laccases, other cellulases, endoglycosidases, endo-beta-1,4-laccases, amyloglucosidases, other glucosidases, glucose isomerases, glycosyltransferases, lipases, phospholipases, lipooxygenases, beta-laccases, endo-beta-1,3(4)-laccases, cutinases, peroxidases, other amylases, xanthanases, glucoamylases, pectinases, reductases, oxidases, decarboxylases, phenoloxidases, ligninases, pullulanases, arabinanases, hemicellulases, mannanases, xylolaccases, xylanases, pectin acetyl esterases, rhamnogalacturonan acetyl esterases, proteases, peptidases, proteinases, polygalacturonases, rhamnogalacturonases, galactanases, pectin lyases, transglutaminases, pectin methylesterases, other cellobiohydrolases and/or transglutaminases enzymes. 
     
     
         29 . The method of  claim 28 , wherein the drilling fluid that is used during an oil and gas well drilling operation is used in a producer well, an injector well, an open hole, a tubular well, a horizontal well or a natural or a man-made fracture; or, the mixture of enzymes is added to an oil and gas well washing and/or fracturing operation comprising a producer well, an injector well, an open hole, a tubular well, a horizontal well or a natural or a man-made fracture,
 wherein optionally the polymer degraded by the enzyme or mixtures (“cocktails”) of enzymes comprise a lignin, a starch, a cellulose, a guar, hydroxyalkyl guar, carboxyalkyl guar, guar gum, guar gum powder, lignified coat of guar seeds or solidified guar gum or a xanthan, or   wherein optionally the enzyme, enzymes or enzyme mixtures (“cocktails”) are formulated to comprise: (a) a starch, a xanthan and/or a cellulose powder; or (b) a mixture of buffer salts and enzyme(s), wherein optionally the formulation is used to prepare a mud.   
     
     
         30 . A method for modifying or adjusting the rheological properties of: a polysaccharide thickener; a polysaccharide thickener in a gel, a flocculate, a binder or a lubricant; or, a polysaccharide in a film to modify a property of the film, the method comprising
 (I) providing a mixture of enzymes, or at least one polymer-degrading (“polymer breaking”) enzyme comprising
 (a) a polypeptide of  claim 7 ; 
 (b) a polypeptide having a sequence of SEQ ID NO: 15 or SEQ ID NO:17; and 
   (II) adding the mixture of enzymes or enzyme to the polysaccharide thickener; the polysaccharide thickener in a gel, a flocculate, a binder or a lubricant; or, the polysaccharide in a film, thereby adjusting or modifying the properties of the gel, flocculate, binder, lubricant or film, or   (III) the method of (I) or (II), wherein the mixture of enzymes comprises at least one, two, three, four, five, six, seven, eight, nine or ten or all of the enzymes selected from the group consisting of a lignin degrading enzyme, alpha amylase, beta amylase, glucoamylase, dextrinase, cellulase, cellobiohydrolase, avicelase, carboxymethylcellulase, beta-glucanase, glucosidase, xylanase, mannanase, arabinofuranosidase, laccase, lignin peroxidase, pectinase, pectate lyase, xanthanase, xanthan lyase, xanthan depolymerase, pullulanase, lichenase, pachymanase, lipase, protease, proteinase, phytase, peptidase and catalase; or amylases, xanthanases, glycosidases, cellulases) the use of any combination of other enzymes such as tryptophanases or tyrosine decarboxylases, laccases, catalases, laccases, other cellulases, endoglycosidases, endo-beta-1,4-laccases, amyloglucosidases, other glucosidases, glucose isomerases, glycosyltransferases, lipases, phospholipases, lipooxygenases, beta-laccases, endo-beta-1,3(4)-laccases, cutinases, peroxidases, other amylases, xanthanases, glucoamylases, pectinases, reductases, oxidases, decarboxylases, phenoloxidases, ligninases, pullulanases, arabinanases, hemicellulases, mannanases, xylolaccases, xylanases, pectin acetyl esterases, rhamnogalacturonan acetyl esterases, proteases, peptidases, proteinases, polygalacturonases, rhamnogalacturonases, galactanases, pectin lyases, transglutaminases, pectin methylesterases, other cellobiohydrolases and/or transglutaminases enzymes.   
     
     
         31 . A composition comprising a polypeptide of  claim 7 ,
 wherein optionally the composition is a pharmaceutical composition, a detergent composition, a contact lens solution, a waste treatment composition, a soap, or a chewing gum, lozenge or candy,   or wherein optionally the composition is a fuel, wherein optionally the composition is an alcohol, wherein optionally the alcohol is ethanol,   or wherein optionally the composition is a biomass material, paper, paper waste, recycled paper product, paper pulp, paper product, wood, wood product, wood pulp, Kraft pulp, textile, fabric, yam, fiber, or a cloth,   or wherein optionally the biomass material is derived from an agricultural crop, is a byproduct of a food or a feed production, is a lignocellulosic waste product, or is a plant residue or a waste paper or waste paper product, and optionally the plant residue comprise stems, leaves, hulls, husks, corn or corn cobs, corn stover, hay, straw, wood, wood chips, wood pulp, wood waste and sawdust, and optionally the paper waste comprises discarded or used photocopy paper, computer printer paper, notebook paper, notepad paper, typewriter paper, newspapers, magazines, cardboard and paper-based packaging materials,   or wherein optionally the composition comprises a a lignin, lignocellulose, a cellulose, a hemicellulose, a lignin, a xylan, a glucan, or a mannan,   or wherein optionally the composition is a beverage, food, food product, feed, food additive, nutritional supplement or a dietary supplement or an edible enzyme delivery matrix.   
     
     
         32 . A method of treating or modifying a composition comprising contacting a composition with the polypeptide of  claim 7 ,
 wherein optionally the composition is a pharmaceutical composition, a detergent composition, a contact lens solution, a waste treatment composition, or a soap,   or wherein optionally the composition is a fuel, wherein optionally the composition is an alcohol, wherein optionally the alcohol is ethanol,   or wherein optionally the composition is a biomass material, paper, paper waste, recycled paper product, paper pulp, paper product, wood, wood product, wood pulp, Kraft pulp, textile, fabric, yam, fiber, or a cloth,   or wherein optionally the biomass material is derived from an agricultural crop, is a byproduct of a food or a feed production, is a lignocellulosic waste product, or is a plant residue or a waste paper or waste paper product, and optionally the plant residue comprise stems, leaves, hulls, husks, corn or corn cobs, corn stover, hay, straw, wood, wood chips, wood pulp, wood waste and sawdust, and optionally the paper waste comprises discarded or used photocopy paper, computer printer paper, notebook paper, notepad paper, typewriter paper, newspapers, magazines, cardboard and paper-based packaging materials,   or wherein optionally the composition comprises a a lignin, lignocellulose, a cellulose, a hemicellulose, a lignin, a xylan, a glucan, or a mannan,   or wherein optionally the composition is a beverage, a food, a feed, a dairy product, a nutritional supplement, a chewing gum, a lozenge or a candy,   or wherein optionally, the method is for fuel, food, feed, nutritional supplement or beverage production.

Join the waitlist — get patent alerts

Track US2019376052A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.