US2019127738A1PendingUtilityA1

Multiple exon skipping compositions for dmd

Assignee: SAREPTA THERAPEUTICS INCPriority: Oct 24, 2008Filed: Jan 9, 2019Published: May 2, 2019
Est. expiryOct 24, 2028(~2.2 yrs left)· nominal 20-yr term from priority
A61P 21/04A61P 21/00C12N 2320/30C12N 2310/3513C12N 15/111C12N 2310/3341C12N 2310/3233C12N 2320/33C12N 2310/11C12N 15/113C12N 2310/321C12N 2310/331A61K 48/00
72
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.

Claims

exact text as granted — not AI-modified
1 - 65 . (canceled) 
     
     
         66 . An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA,
 wherein the base sequence comprises 19 consecutive bases of   
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 431) 
                 
                     
                   CTGTTGCCTCCGGTTCTGAAGGTGT, 
                 
             
                
                
               
            
           
         
         wherein the antisense oligonucleotide is a morpholino oligomer, and 
         wherein the antisense oligonucleotide induces exon 53 skipping; 
         or a pharmaceutically acceptable salt thereof. 
       
     
     
         67 . A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising
 a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA,
 wherein the base sequence comprises 19 consecutive bases of 
   
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 431) 
                 
                     
                   CTGTTGCCTCCGGTTCTGAAGGTGT, 
                 
             
                
                
               
            
           
         
         
           wherein the antisense oligonucleotide is a morpholino oligomer, and 
           wherein the antisense oligonucleotide induces exon 53 skipping; 
         
         or a pharmaceutically acceptable salt thereof; and 
         a pharmaceutically acceptable carrier.

Join the waitlist — get patent alerts

Track US2019127738A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.