Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

1 - 82 . (canceled) 
     
     
         83 . A single-molecule DNA-targeting RNA having the structure: 
       
         
           
           
               
               
           
         
         wherein the linker is nnnn such that the single-molecule DNA-targeting RNA has the nucleotide sequence nnnnnnnnnnnnnnnnnnnnGUUUUAGAGCUAnnnnUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 680). 
       
     
     
         84 . The single-molecule DNA-targeting RNA of  claim 83 , wherein the linker is GAAA such that the single-molecule DNA-targeting RNA has the structure: 
       
         
           
                 
                 
               
                     
                   5′-20-nt targeting seq-GUUUUAGAGCUA G   A   
                 
                     
                                           |||||| |||| 
                 
                     
                           3′-GCCUGAUCGGAAUAAAAUU CGAU A   A   
                 
                     
                                                GAA 
                 
             
                
                
                
                
               
            
           
         
         wherein “20-nt targeting seq” is nnnnnnnnnnnnnnnnnnnn. 
       
     
     
         85 . The single-molecule DNA-targeting RNA of  claim 83 , wherein the nucleotide sequence of the single-molecule DNA-targeting RNA is GAUUUCUUCUUGCGCUUUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 321). 
     
     
         86 . The single-molecule DNA-targeting RNA of  claim 83 , wherein the single-molecule DNA-targeting RNA is capable of hybridizing to a nucleic acid that encodes green fluorescent protein, and the nucleotide sequence of the single-molecule DNA-targeting RNA is CCAAUUCUUGUUGAAUUAGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 406). 
     
     
         87 . A method of cleaving a target DNA, the method comprising:
 contacting a target DNA with:   (a) the single molecule DNA-targeting RNA of  claim 84 , wherein nnnnnnnnnnnnnnnnnnnn is a DNA-targeting segment that hybridizes with a target sequence of the target DNA; and   (b) a Cas9 protein comprising the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2,   wherein said contacting does not take place inside of a cell, and   wherein the target DNA is cleaved.   
     
     
         88 . The method of  claim 87 , wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs. 
     
     
         89 . The method of  claim 88 , wherein at least two of the two or more single molecule DNA-targeting RNAs hybridize to locations on the target DNA that are separated from one another by greater than 100 base pairs (bp). 
     
     
         90 . A method of cleaving a target DNA, the method comprising:
 contacting a target DNA with a complex comprising:   (a) the single molecule DNA-targeting RNA of  claim 85 ; and   (b) a Cas9 protein comprising the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2, wherein prior to said contacting the target DNA is double stranded and comprises a nucleotide sequence taatgaattccccaatacccaaaaagcgcaagaagaaatcaaccagcgca (SEQ ID NO: 302) hybridized to a nucleotide sequence tgcgctggttgatttcttcttgcgctttttgggtattggggaattcatta (SEQ ID NO: 301),   wherein said contacting does not take place inside of a cell, and   wherein the target DNA is cleaved.   
     
     
         91 . A method of cleaving a target DNA, the method comprising:
 contacting a target DNA with a complex comprising:   (a) the single molecule DNA-targeting RNA of  claim 86 ; and   (b) a Cas9 protein comprising the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2, wherein prior to said contacting the target DNA is double stranded, encodes green fluorescent protein, and comprises the nucleotide sequence set forth as SEQ ID NO.: 325 hybridized to the nucleotide sequence set forth as SEQ ID NO.: 326,   wherein said contacting does not take place inside of a cell, and   wherein the target DNA is cleaved.   
     
     
         92 . A method of nicking a double stranded target DNA, the method comprising:
 contacting a double stranded target DNA with:   (a) the single molecule DNA-targeting RNA of  claim 84 , wherein nnnnnnnnnnnnnnnnnnnn is a DNA-targeting segment that hybridizes with a target sequence of the target DNA; and   (b) a Cas9 protein comprising the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2, except that the Cas9 protein includes a D10A mutation,   wherein said contacting does not take place inside of a cell, and   wherein a single strand of the target DNA is cleaved.   
     
     
         93 . A method of nicking a double stranded target DNA, the method comprising:
 contacting a double stranded target DNA with:   (a) the single molecule DNA-targeting RNA of  claim 84 , wherein nnnnnnnnnnnnnnnnnnnn is a DNA-targeting segment that hybridizes with a target sequence of the target DNA; and   (b) a Cas9 protein comprising the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2, except that the Cas9 protein includes an H840A mutation,   wherein said contacting does not take place inside of a cell, and   wherein a single strand of the target DNA is cleaved.   
     
     
         94 . The method of  claim 92 , wherein the method comprises contacting the double stranded target DNA with two or more single molecule DNA-targeting RNAs. 
     
     
         95 . The method of  claim 94 , wherein at least two of the two or more single molecule DNA-targeting RNAs hybridize to locations on the target DNA that are separated from one another by greater than 100 base pairs (bp). 
     
     
         96 . The method of  claim 93 , wherein the method comprises contacting the double stranded target DNA with two or more single molecule DNA-targeting RNAs. 
     
     
         97 . The method of  claim 96 , wherein at least two of the two or more single molecule DNA-targeting RNAs hybridize to locations on the target DNA that are separated from one another by greater than 100 base pairs (bp). 
     
     
         98 . A genetically modified non-human organism, comprising a nucleic acid that comprises a nucleotide sequence encoding a Cas9 protein that comprises the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2, wherein the genetically modified non-human organism is a plant or an animal. 
     
     
         99 . The genetically modified non-human organism of  claim 98 , wherein the genetically modified non-human organism is an animal. 
     
     
         100 . The genetically modified non-human organism of  claim 99 , wherein the animal is a rodent or a non-human primate. 
     
     
         101 . The genetically modified non-human organism of  claim 98 , wherein the nucleotide sequence encoding the Cas9 protein is operably linked to an inducible promoter. 
     
     
         102 . A single-molecule DNA-targeting RNA, wherein the single-molecule DNA-targeting RNA is capable interacting with a Cas9 protein and hybridizing to a target sequence of a chromosomal target DNA in a mammalian cell, wherein the nucleotide sequence of the single-molecule DNA-targeting RNA is: 
       
         
           
                 
               
                   (SEQ ID NO: 428) 
                 
                   GCAGAUGUAGUGUUUCCACAGUUUUAGAGCUAGAAAUAGCAAGUUAA 
                 
                   AAUAAGGCUAGUCCG,, 
                 
                   or 
                 
                     
                 
                   (SEQ ID NO: 429) 
                 
                   GCAGAUGUAGUGUUUCCACAGUUUUAGAGCUAUGCUGAAAAGCAUAG 
                 
                   CAAGUUAAAAUAAGGCUAGUCCGUUAUC, 
                 
                   or 
                 
                     
                 
                   (SEQ ID NO: 430) 
                 
                   GCAGAUGUAGUGUUUCCACAGUUUUAGAGCUAUGCUGUUUUGGAAAC 
                 
                   AAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUC. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         103 . A method of cleaving a chromosomal target DNA in a human cell in culture, the method comprising:
 introducing into a human cell in culture:   (a) the single molecule DNA-targeting RNA of  claim 102 , or a nucleic acid encoding said single molecule DNA-targeting RNA; and   (b) a Cas9 protein, or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein comprises the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2 and is fused to an HA epitope, a nuclear localization signal (NLS), and green fluorescent protein (GFP),   wherein the target DNA is cleaved.   
     
     
         104 . A method of reducing transcription from a target DNA, the method comprising:
 contacting a target DNA in a bacterial cell with:
 (a) a dead Cas9 (dCas9) protein consisting essentially of the  S. pyogenes  Cas9 amino acid sequence set forth as SEQ ID NO.: 2, except that the dCas9 protein includes a D10A mutation and an H840A mutation; and 
 (b) a single molecule DNA-targeting RNA having the nucleotide sequence nnnnnnnnnnnnnnnnnnnnGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC CGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 682), 
 wherein nnnnnnnnnnnnnnnnnnnn is a 20 nucleotide (nt) DNA-targeting segment that hybridizes with a target sequence of the target DNA, 
   wherein (a) forms a complex with (b), thereby targeting the dCas9 protein to the target sequence of the target DNA,   wherein said contacting results in reduced transcription from the target DNA.