Method for detecting infectious parvovirus in pharmaceutical preparations

Abstract

The present invention provides methods for detecting viral infectivity and content in an enzyme preparation. In certain embodiments, the invention relates to methods for producing a pharmaceutical pancreatic enzyme composition. In additional embodiments, the invention relates to detecting infectious porcine parvovirus (PPV) and determining PPV content in pancreatic enzyme preparations (PEPs), including pancrelipase preparations.

1 . A method for detecting infectious non-enveloped virus in a pancreatic enzyme preparation (PEP) comprising:
 a. extracting a sample of the preparation at least two times with chloroform producing a clarified sample with an upper phase and a lower phase;   b. precipitating an aliquot of the upper phase from step a) with polyethylene glycol (PEG);   c. suspending the product from step b) in a buffer;   d. precipitating the product from step c) with PEG;   e. suspending the product from step d) in a solution;   f. optionally extracting the product from step e) with chloroform producing a clarified sample with an upper phase and a lower phase; the upper phase forming a purified solution;   g. detecting the presence of infectious virus in the solution, and   h. determining whether viral load is below threshold fluorescence focus infectious dose (FFID 50 ) PPV viral load of about 10 5  FFID 50 .   
     
     
         2 . The method of  claim 1 , wherein the sample which is to be extracted in step (a) is prepared by solubilizing a portion or all of the pancreatic enzyme preparation in buffer, and mixing the solution for up to about 24 hours. 
     
     
         3 . The method of  claim 1 , wherein the sample which is to be extracted in step (a) is prepared by solubilizing a portion or all of the pancreatic enzyme preparation in buffer, and mixing the solution for up to about 2 hours. 
     
     
         4 . The method of  claim 2 , wherein the buffer is an alkaline buffer. 
     
     
         5 . The method of  claim 1 , further comprising performing nucleic acid amplification on an aliquot from step f), and producing an amplification profile that indicates viral content of the composition. 
     
     
         6 . The method of  claim 1 , wherein the enzyme preparation is a pancreatic enzyme preparation. 
     
     
         7 . The method of  claim 6 , wherein the pancreatic enzyme preparation is derived from porcine pancrelipase. 
     
     
         8 . The method of  claim 7 , wherein the pancreatic enzyme preparation is pancrelipase or pancreatine comprising various ratios of at least three enzymes selected from the group consisting of lipase, amylase, and protease. 
     
     
         9 . The method of  claim 1 , wherein the infectious non-enveloped virus is porcine parvovirus (PPV). 
     
     
         10 . The method of  claim 1 , wherein the presence of infectious virus is determined using an infectivity assay system comprising a detection agent for detecting the virus. 
     
     
         11 . The method of  claim 1 , wherein the presence of infectious virus is determined by immunofluorescence. 
     
     
         12 . The method of  claim 1 , wherein the presence of infectious virus is determined with a fluorescence-focus units system comprising a specific detection agent for the virus. 
     
     
         13 . The method of  claim 5 , wherein the nucleic acid amplification is polymerase chain reaction (PCR). 
     
     
         14 . The method of  claim 13 , wherein the PCR is performed using the primer AGTGGGTATCGCTACTAACCTACACTC (SEQ ID NO:3) or GATCTGTCATCATCCAGTCTTCTATGC (SEQ ID NO:4). 
     
     
         15 . The method of  claim 13 , wherein the PCR is performed in the presence of predetermined amounts of competitor DNA having the sequence: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 5) 
                 
                     
                   AGTGGGTATC GCTACTAACC TACACTCGGA AATATGATTG 
                 
                     
                     
                 
                     
                   CTTACTACTT CCTAAATAAA AAAAGAAAGA CAACTGAAAG 
                 
                     
                     
                 
                     
                   AGAGCATGGA TATTATCTCA GCTCAGATTC TGGCTTCATG 
                 
                     
                     
                 
                     
                   ACAAATTTCT TAAAAGAAGG CGAGAGACAC TTAGTCAGTC 
                 
                     
                     
                 
                     
                   ACCTATTTAC TGAAGCAAAT AAACCTGAAA CTGTGGAAAC 
                 
                     
                     
                 
                     
                   AACGGTTACT ACAGCTCAGG AAGCCAAAAG AGGCAGAATA 
                 
                     
                     
                 
                     
                   CAAACAAAAA AAGAAGTAAG CATAAAATGC ACAATAAGAG 
                 
                     
                     
                 
                     
                   ACTTGGTTAA TAAAAGATGT ACTAGCATAG AAGACTGGAT 
                 
                     
                     
                 
                     
                   GATGACAGAT C 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         16 . (canceled) 
     
     
         17 . (canceled) 
     
     
         18 . (canceled) 
     
     
         19 . (canceled) 
     
     
         20 . (canceled) 
     
     
         21 . (canceled) 
     
     
         22 . A method for evaluating a pancreatic enzyme preparation comprising:
 a. extracting a sample of the preparation at least two times with chloroform producing a clarified sample with an upper phase and a lower phase;   b. precipitating an aliquot of the upper phase from step a) with polyethylene glycol (PEG);   c. suspending the product from step b) in a buffer;   d. precipitating the product from step c) with PEG;   e. suspending the product from step d) in a solution;   f. optionally extracting the product from step e) with chloroform producing a clarified sample with an upper phase and a lower phase; the upper phase forming a purified solution;   g. detecting the presence of infectious virus or measuring infectious virus load in the solution; and   h. selecting a pancreatic enzyme preparation for pharmaceutical production when the presence of infectious virus or viral content are below a fluorescence focus infectious dose (FFID 50 ) PPV viral load of about 10 5  FFID 50 .   
     
     
         23 . A pharmaceutical pancreatic enzyme preparation evaluated according to the method of  claim 1 . 
     
     
         24 . A method for producing a pharmaceutical pancreatic enzyme preparation comprising detecting infectious non-enveloped virus by the method of  claim 1 . 
     
     
         25 . (canceled) 
     
     
         26 . A method of controlling steatorrhea in a patient in need thereof, or treating a patient with partial or complete exocrine pancreatic, insufficiency comprising:
 (i) obtaining a pancreatic enzyme preparation;   (ii) detecting or measuring the amount of infectious non-enveloped virus in the pancreatic enzyme preparation by   a. extracting a sample of the preparation at least two times with chloroform producing a clarified sample with an upper phase and a lower phase;   b. precipitating an aliquot of the upper phase from step a) with polyethylene glycol (PEG);   c. suspending the product from step b) in a buffer;   d. precipitating the product from step c) with PEG;   e. suspending the product from step d) in a solution; and   f. optionally extracting the product from step e) with chloroform producing a clarified sample with an upper phase and a lower phase; the upper phase forming a purified solution; and   g. determining the infectious virus load in the solution is below a threshold level, wherein the threshold level is below a fluorescence focus infectious dose (FFID 50 ) PPV viral load of about 10 5  FFID 50 ; and   (iii) administering an effective amount of the pancreatic enzyme preparation to the patient when the infectious load in the pancreatic enzyme preparation are below a threshold level.   
     
     
         27 . A method for producing a pharmaceutical product containing a pancreatic enzyme preparation comprising:
 a. obtaining a sample of the pancreatic enzyme preparation;   b. detecting the viral load in the sample comprising:
 i. extracting a sample of the pancreatic enzyme preparation at least two times with chloroform producing a clarified sample with an upper phase and a lower phase; 
 ii. precipitating an aliquot of the upper phase from step i) with polyethylene glycol (PEG); 
 iii. suspending the product from step ii) in a buffer; 
 iv. precipitating the product from step iii) with PEG; 
 v. suspending the product from step iv) in an aqueous solution; 
 vi. extracting the product from step v) with chloroform producing a clarified sample with an upper phase and a lower phase; the upper phase forming a purified solution; 
 vii. determining the infectious PPV virus load in the purified solution; and 
   c. mixing the remainder of the pancreatic enzyme preparation with one or more pharmaceutically acceptable excipients to afford a pharmaceutical product comprising a pancreatic enzyme preparation, if the viral load measured in step b) is below wherein the load of virus is below a fluorescence focus infectious dose (FFID 50 ) PPV viral load of about 10 5  FFID 50 .   
     
     
         28 . A method of  claim 27 , wherein the PEG is PEG 8000. 
     
     
         29 . The method of  claim 27 , wherein the pancreatic enzyme preparation is pancrelipase or pancreatine comprising various ratios of at least three enzymes selected from the group consisting of lipase, amylase, and protease.