Splice modulating oligonucleotides that inhibit cancer

Abstract

A method of treating cancer in a subject is provided. The method includes administering a splice modulating oligonucleotide to the subject in an amount effective to provide a therapeutic benefit to the subject. In the method, the oligonucleotide modifies splicing of a pre-mRNA encoding a polypeptide promotes cancer cell survival, proliferation, and/or metastasis, or promotes angiogenesis, or a combination thereof; or increases expression of the polypeptide if the polypeptide inhibits angiogenesis, or a combination thereof. Similar methods of treating diseases involving prolactin or the prolactin receptor are also provided.

1 - 19 . (canceled) 
     
     
         20 . A single-stranded splice modulating oligonucleotide, wherein the oligonucleotide
 (i) is at least eight nucleotides in length;   (ii) comprises at least eight contiguous nucleotides in a sequence that is at least 90% complementary to a target sequence in a prolactin receptor pre-mRNA; and   (iii) comprises a modified oligonucleotide backbone.   
     
     
         21 . The oligonucleotide of  claim 20 , wherein the prolactin receptor pre-mRNA has 10 exons. 
     
     
         22 . The oligonucleotide of  claim 21 , wherein the target sequence comprises a 3′ splice site. 
     
     
         23 . The oligonucleotide of  claim 21 , wherein the target sequence is within 10 nucleotides of the junction of an intron and an exon in the prolactin receptor pre-mRNA. 
     
     
         24 . The oligonucleotide of  claim 23 , wherein the target sequence comprises the intron-exon junction of exon 10 in the prolactin receptor pre-mRNA. 
     
     
         25 . The oligonucleotide of  claim 21 , wherein the target sequence comprises UGUGUCUGUGUUUUAAUAGAAGGGC (SEQ ID NO: 33), CUUGAGUU (SEQ ID NO: 34), CCCUCUAG (SEQ ID NO: 35), or GUACUGUUUUU (SEQ ID NO: 36) 
     
     
         26 . The oligonucleotide of  claim 21 , wherein hybridization of the oligonucleotide to its target sequence inhibits splicing of exon 10 in the prolactin receptor pre-mRNA. 
     
     
         27 . The oligonucleotide of  claim 20 , comprising the sequence GCCCTTCTATTAAAACACAGACACA (SEQ ID NO:37) or GCCCTTCTATTGAAACACAGATACA (SEQ ID NO:38). 
     
     
         28 . The oligonucleotide of  claim 20 , which comprises DNA nucleotides, RNA nucleotides, or a combination thereof. 
     
     
         29 . The oligonucleotide of  claim 20 , comprising nucleotides that are linked with a phosphorothioate, a phosphorodithioate, a chiral phosphorodithioate, a phosphotriester, an aminoalkylphosphotriester, an alkyl phosphonate, a methyl phosphonate, a 3′-alkylene phosphonate, a chiral phosphonate, a phosphinate, a phosphoramidate, a 3′-amino phosphoramidates, an aminoalkylphosphoramidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkyl phosphotriester, or a boranophosphate backbone. 
     
     
         30 . The oligonucleotide of  claim 29 , comprising a phosphorothioate backbone. 
     
     
         31 . The oligonucleotide of  claim 20 , which is a morpholino oligonucleotide. 
     
     
         32 . The oligonucleotide of  claim 20 , which comprises morpholino groups and octaguanidine groups. 
     
     
         33 . The oligonucleotide of  claim 20 , which is 8-50 nucleotides in length. 
     
     
         34 . The oligonucleotide of  claim 32 , which is 10-25 nucleotides in length. 
     
     
         35 . The oligonucleotide of  claim 32 , which is 20-30 nucleotides in length. 
     
     
         36 . The oligonucleotide of  claim 32 , comprising at least 8 contiguous nucleotides in a sequence that is 100% complementary to the target sequence.