Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

1 - 2 . (canceled) 
     
     
         3 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (A) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex comprising:
 (i) a Cas9 protein; 
 (ii) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA molecule; and 
 (iii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex, of a DNA-targeting RNA, that binds to the Cas9 protein, 
 wherein said assembling comprises combining (i), (ii), and (iii) under conditions suitable for formation of the DNA-targeting RNA/polypeptide complex; and 
   (B) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule,   wherein the Cas9 protein and the DNA-targeting RNA do not naturally occur together, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         4 . The method of  claim 3 , wherein the nucleotide sequence of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long. 
     
     
         5 . The method of  claim 3 , wherein the nucleotide sequence, of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long. 
     
     
         6 . The method of  claim 5 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the nucleotide sequence that is complementary to the target sequence of the target DNA molecule. 
     
     
         7 . The method of  claim 3 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         8 . The method of  claim 3 , wherein, prior to assembly of the DNA-targeting RNA/polypeptide complex, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         9 . The method of  claim 8 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         10 . The method of  claim 9 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         11 . The method of  claim 8 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         12 . The method of  claim 11 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         13 . The method of  claim 11 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         14 . The method of  claim 3 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41. 
     
     
         15 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (1) incubating, in vitro outside of a cell, a targeter-RNA with an activator-RNA to form a DNA-targeting RNA,
 wherein the targeter-RNA comprises a nucleotide sequence that is complementary to a target sequence of the target DNA molecule, and the targeter-RNA and activator-RNA hybridize with one another to form a duplex; 
   (2) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex by combining the DNA-targeting RNA with a Cas9 protein, wherein the DNA-targeting RNA/polypeptide complex comprises the Cas9 protein, the targeter-RNA, and the activator-RNA; and   (3) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule,   wherein the Cas9 protein and the DNA-targeting RNA do not naturally occur together, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         16 . The method of  claim 15 , wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long. 
     
     
         17 . The method of  claim 15 , wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long. 
     
     
         18 . The method of  claim 15 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the nucleotide sequence that is complementary to the target sequence of the target DNA molecule. 
     
     
         19 . The method of  claim 15 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         20 . The method of  claim 15 , wherein, prior to said incubating, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and prior to said assembling, the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         21 . The method of  claim 20 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         22 . The method of  claim 21 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         23 . The method of  claim 20 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         24 . The method of  claim 23 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         25 . The method of  claim 23 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         26 . The method of  claim 15 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41.