Methods for detecting enhanced nmda receptor function and uses thereof

Abstract

A method of determining the risk of cognitive decline in an aging subject is provided. The method includes analyzing an MRNA transcript including a GRIN2B nucleic acid sequence for the presence of the A allele in a biological sample obtained from the subject. The method also includes identifying the subject as having a decreased risk of cognitive decline when the A allele is present.

What is claimed is: 
     
         1 . A method to delay the onset of cognitive decline in a subject, the method comprising administering a composition including a compound that increases GRIN2B activity or expression. 
     
     
         2 . The method of  claim 1 , wherein the cognitive decline is due to dementia. 
     
     
         3 . A method for identifying a candidate individual for administering a composition comprising a compound that increases GRIN2B activity or expression, the method comprising:
 a) analyzing an MRNA transcript including a GRIN2B nucleic acid sequence for the presence of an A allele in a biological sample obtained from the subject;   b) classifying the biological sample as (i) having the A allele if GGAA is detected 310 base pairs upstream of the transcription start site for the GRIN2B nucleic acid sequence or (ii) not having the A allele if GGGA is detected 310 base pairs upstream of the transcription start site for the GRIN2B nucleic acid sequence; and   c) administering the composition to the biological sample;   d) conducting testing to determine response of the biological sample to the composition;   e) analyzing an MRNA transcript of an individual including a GRIN2B nucleic acid sequence for the presence of an A allele in a biological sample obtained from the subject;   f) classifying the individual as (i) having the A allele if GGAA is detected 310 base pairs upstream of the transcription start site for the GRIN2B nucleic acid sequence or (ii) not having the A allele if GGGA is detected 310 base pairs upstream of the transcription start site for the GRIN2B nucleic acid sequence;   g) determining whether the individual is or is not a candidate for administering the composition based on the classification of the individual from the presence or absence of the A allele.   
     
     
         4 . The method of  claim 3 , wherein the A allele is detected by sequencing. 
     
     
         5 . The method of  claim 3 , wherein the A allele is detected by hybridization of a probe specific to the A allele. 
     
     
         6 . The method of  claim 5 , wherein the probe comprises SEQ ID NO:6 (CATCTCCGGGGAACACGCGAA). 
     
     
         7 . The method of  claim 3 , wherein SNP r53764030 is detected about 310 base pairs upstream of the transcription start site for the GRIN2B nucleic acid sequence. 
     
     
         8 . The method of  claim 3 , wherein the candidate is homozygous for the A allele if only GGAA is detected. 
     
     
         9 . The method of  claim 3 , wherein the candidate is heterozygous for the A allele if GGAA and GGGA are detected.