US2018273981A1PendingUtilityA1
Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
Est. expiryMay 25, 2032(~5.8 yrs left)· nominal 20-yr term from priority
H10P 14/6512H10P 14/20A61P 43/00A61P 35/00A61P 31/12A61P 31/00A61P 31/04C12Q 1/686C12N 2310/3519C12N 2310/13C12N 15/111C12Y 301/04C12N 2310/531C12N 15/907C12N 2310/11A61K 38/465C12N 2310/32C12N 2310/20C12N 15/63A01H 6/4684A61K 48/00C12N 2310/33C07K 2319/85C12N 2800/80C12N 15/113C12N 15/746C12N 9/22C12N 15/90C12N 15/102C07K 2319/71C12N 15/902C12N 5/10C12N 2310/31C12N 2310/14C12N 15/70A01K 67/027H10H 20/0137C12N 9/226Y02A50/30
79
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
Claims
exact text as granted — not AI-modified1 - 2 . (canceled)
3 . A method of modifying a DNA molecule, cleaving a DNA molecule, and/or targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA that comprises:
an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
the targeter-RNA, comprising
(i) a first nucleotide sequence that is not found in naturally occurring crRNA, and that comprises a sequence which hybridizes to a target sequence of the DNA molecule; and
(ii) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex,
thereby modifying the DNA molecule, cleaving the DNA molecule, and/or targeting the Cas9 protein to the target sequence of the DNA molecule.
4 . The method of claim 3 , wherein said contacting results in modification of the DNA molecule.
5 . The method of claim 3 , wherein said contacting results in cleavage of the DNA molecule.
6 . The method of claim 5 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
7 . The method of claim 3 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
8 . The method of claim 3 , wherein the Ca9 protein is fused to a heterologous polypeptide.
9 . The method of claim 8 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
10 . The method of claim 3 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
11 . The method of claim 3 , wherein the sequence which hybridizes to the target sequence of the DNA molecule is 15 nucleotides (nt) to 18 nt long.
12 . The method of claim 3 , wherein the sequence which hybridizes to the target sequence of the DNA molecule is 18 nucleotides (nt) to 25 nt long.
13 . The method of claim 3 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
14 . The method of claim 3 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
15 . The method of claim 3 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
16 . The method of claim 3 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
17 . The method of claim 3 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
18 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
19 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
20 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
21 . The method of claim 3 , wherein the DNA molecule is chromosomal DNA.
22 . The method of claim 3 , wherein said contacting comprises introducing into a cell containing the DNA molecule, one or more of:
the activator-RNA, or a nucleic acid encoding the activator-RNA; the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and the Cas9 protein, or a nucleic acid encoding the Cas9 protein.
23 . The method of claim 22 , wherein at least one of: the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein; is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
24 . The method of claim 22 , wherein the cell is a bacterial cell.
25 . The method of claim 22 , further comprising introducing into the cell a donor polynucleotide.
26 . The method of claim 22 , wherein (1) an isolated nucleic acid encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.
27 . The method of claim 22 , wherein an (1) mRNA encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.
28 . The method of claim 22 , wherein (1) an isolated nucleic acid encoding the Cas9 protein, and (2) one or more isolated nucleic acids encoding an activator-RNA and a targeter-RNA, are introduced into the cell.
29 . The method of claim 22 , wherein the Cas9 protein, an activator-RNA, and a targeter-RNA are introduced into the cell.
30 . A method of targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA that comprises:
an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
the targeter-RNA, comprising
(i) a first nucleotide sequence that is not found in naturally occurring crRNA and that comprises a sequence which hybridizes to a target sequence of the DNA molecule; and
(ii) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex,
thereby targeting the Cas9 protein to the target sequence, wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell.
31 . The method of claim 30 , wherein said contacting results in modification of the DNA molecule.
32 . The method of claim 30 , wherein said contacting results in cleavage of the DNA molecule.
33 . The method of claim 32 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
34 . The method of claim 30 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
35 . The method of claim 30 , wherein the Ca9 protein is fused to a heterologous polypeptide.
36 . The method of claim 35 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
37 . The method of claim 30 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
38 . The method of claim 30 , wherein the sequence which hybridizes to the target sequence of the DNA molecule is 15 nucleotides (nt) to 18 nt long.
39 . The method of claim 30 , wherein the sequence which hybridizes to the target sequence of the DNA molecule is 18 nucleotides (nt) to 25 nt long.
40 . The method of claim 30 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
41 . The method of claim 30 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
42 . The method of claim 30 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
43 . The method of claim 30 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
44 . The method of claim 30 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
45 . The method of claim 30 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
46 . The method of claim 30 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
47 . The method of claim 30 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
48 . The method of claim 30 , wherein the DNA molecule is chromosomal DNA.
49 . A method of modifying a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA that comprises:
an activator-RNA that hybridizes with a targete RNA to form a duplex that binds to the Cas9 protein, and
the targeter-RNA, comprising
(i) a first nucleotide sequence that is not found in naturally occurring crRNA and that comprises a sequence which hybridizes to a target sequence of the DNA molecule; and
(ii) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex,
wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in modification of the DNA molecule.
50 . The method of claim 49 , wherein said modification is cleavage of the DNA molecule.
51 . The method of claim 50 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
52 . The method of claim 49 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
53 . The method of claim 49 , wherein the Ca9 protein is fused to a heterologous polypeptide.
54 . The method of claim 53 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
55 . The method of claim 49 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
56 . The method of claim 49 , wherein the sequence which hybridizes to the target sequence of the DNA molecule is 15 nucleotides (nt) to 18 nt long.
57 . The method of claim 49 , wherein the sequence which hybridizes to the target sequence of the DNA molecule is 18 nucleotides (nt) to 25 nt long.
58 . The method of claim 49 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
59 . The method of claim 49 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
60 . The method of claim 49 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
61 . The method of claim 49 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
62 . The method of claim 49 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
63 . The method of claim 49 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
64 . The method of claim 49 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
65 . The method of claim 49 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
66 . The method of claim 49 , wherein the DNA molecule is chromosomal DNA.
67 . A method of cleaving a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA that comprises:
an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
the targeter-RNA, comprising
(i) a first nucleotide sequence that is not found in naturally occurring crRNA and that comprises a sequence which hybridizes to a target sequence of the DNA molecule; and
(ii) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex,
wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in cleavage of the DNA molecule.
68 . The method of claim 67 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
69 . The method of claim 67 , wherein the Ca9 protein is fused to a heterologous polypeptide.
70 . The method of claim 67 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
71 . The method of claim 67 , wherein the sequence which hybridizes to the target sequence of the DNA molecule is 15 nucleotides (nt) to 18 nt long.
72 . The method of claim 67 , wherein the sequence which hybridizes to the target sequence of the DNA molecule is 18 nucleotides (nt) to 25 nt long.
73 . The method of claim 67 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
74 . The method of claim 67 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
75 . The method of claim 67 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
76 . The method of claim 67 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
77 . The method of claim 67 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
78 . The method of claim 67 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
79 . The method of claim 67 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
80 . The method of claim 67 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
81 . The method of claim 67 , wherein the DNA molecule is chromosomal DNA.
82 . A method of modifying a DNA molecule, cleaving a DNA molecule, and/or targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(I) a Cas9 protein; and
(II) a DNA-targeting RNA that comprises:
(A) an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
(B) the targeter-RNA, comprising:
(a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and
(b) a DNA-targeting segment that is fused to and positioned 5′ of the duplex-forming segment,
wherein the DNA-targeting segment: (i) comprises a nucleotide sequence that hybridizes to a target sequence of the DNA molecule, and (ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA,
thereby modifying the DNA molecule, cleaving the DNA molecule, and/or targeting the Cas9 protein to the target sequence of the DNA molecule.
83 . The method of claim 82 , wherein said contacting results in modification of the DNA molecule.
84 . The method of claim 82 , wherein said contacting results in cleavage of the DNA molecule.
85 . The method of claim 84 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
86 . The method of claim 82 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
87 . The method of claim 82 , wherein the Ca9 protein is fused to a heterologous polypeptide.
88 . The method of claim 87 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
89 . The method of claim 82 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
90 . The method of claim 82 , wherein the nucleotide sequence that hybridizes to the target sequence is 15 nucleotides (nt) to 18 nt long.
91 . The method of claim 82 , wherein the nucleotide sequence that hybridizes to the target sequence is 18 nucleotides (nt) to 25 nt long.
92 . The method of claim 82 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
93 . The method of claim 82 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
94 . The method of claim 82 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
95 . The method of claim 82 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
96 . The method of claim 82 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
97 . The method of claim 82 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
98 . The method of claim 82 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
99 . The method of claim 82 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
100 . The method of claim 82 , wherein the DNA molecule is chromosomal DNA.
101 . The method of claim 82 , wherein said contacting comprises introducing into a cell containing the DNA molecule, one or more of:
the activator-RNA, or a nucleic acid encoding the activator-RNA; the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and the Cas9 protein, or a nucleic acid encoding the Cas9 protein.
102 . The method of claim 101 , wherein at least one of: the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein; is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
103 . The method of claim 101 , wherein the cell is a bacterial cell.
104 . The method of claim 101 , further comprising introducing into the cell a donor polynucleotide.
105 . The method of claim 101 , wherein (1) an isolated nucleic acid encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.
106 . The method of claim 101 , wherein an (1) mRNA encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.
107 . The method of claim 101 , wherein (1) an isolated nucleic acid encoding the Cas9 protein, and (2) one or more isolated nucleic acids encoding an activator-RNA and a targeter-RNA, are introduced into the cell.
108 . The method of claim 101 , wherein the Cas9 protein, an activator-RNA, and a targeter-RNA are introduced into the cell.
109 . A method of targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(I) a Cas9 protein; and
(II) a DNA-targeting RNA that comprises:
(A) an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
(B) the targeter-RNA, comprising:
(a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and
(b) a DNA-targeting segment that is fused to and positioned 5′ of the duplex-forming segment,
wherein the DNA-targeting segment: (i) comprises a nucleotide sequence that hybridizes to a target sequence of the DNA molecule, and (ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA,
thereby targeting the Cas9 protein to the target sequence, wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell.
110 . The method of claim 109 , wherein said contacting results in modification of the DNA molecule.
111 . The method of claim 109 , wherein said contacting results in cleavage of the DNA molecule.
112 . The method of claim 109 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
113 . The method of claim 109 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
114 . The method of claim 109 , wherein the Ca9 protein is fused to a heterologous polypeptide.
115 . The method of claim 114 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
116 . The method of claim 109 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
117 . The method of claim 109 , wherein the nucleotide sequence that hybridizes to the target sequence is 15 nucleotides (nt) to 18 nt long.
118 . The method of claim 109 , wherein the nucleotide sequence that hybridizes to the target sequence is 18 nucleotides (nt) to 25 nt long.
119 . The method of claim 109 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
120 . The method of claim 109 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
121 . The method of claim 109 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
122 . The method of claim 109 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
123 . The method of claim 109 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
124 . The method of claim 109 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
125 . The method of claim 109 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
126 . The method of claim 109 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
127 . The method of claim 109 , wherein the DNA molecule is chromosomal DNA.
128 . A method of modifying a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(I) a Cas9 protein; and
(II) a DNA-targeting RNA that comprises:
(A) an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
(B) the targeter-RNA, comprising:
(a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and
(b) a DNA-targeting segment that is fused to and positioned 5′ of the duplex-forming segment,
wherein the DNA-targeting segment: (i) comprises a nucleotide sequence that hybridizes to a target sequence of the DNA molecule, and (ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA,
wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in modification of the DNA molecule.
129 . The method of claim 128 , wherein said modification is cleavage of the DNA molecule.
130 . The method of claim 129 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
131 . The method of claim 128 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
132 . The method of claim 128 , wherein the Ca9 protein is fused to a heterologous polypeptide.
133 . The method of claim 132 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
134 . The method of claim 128 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
135 . The method of claim 128 , wherein the nucleotide sequence that hybridizes to the target sequence is 15 nucleotides (nt) to 18 nt long.
136 . The method of claim 128 , wherein the nucleotide sequence that hybridizes to the target sequence is 18 nucleotides (nt) to 25 nt long.
137 . The method of claim 128 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
138 . The method of claim 128 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
139 . The method of claim 128 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
140 . The method of claim 128 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
141 . The method of claim 128 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
142 . The method of claim 128 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
143 . The method of claim 128 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
144 . The method of claim 128 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
145 . The method of claim 128 , wherein the DNA molecule is chromosomal DNA.
146 . A method of cleaving a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(I) a Cas9 protein; and
(II) a DNA-targeting RNA that comprises:
(A) an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
(B) the targeter-RNA, comprising:
(a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and
(b) a DNA-targeting segment that is fused to and positioned 5′ of the duplex-forming segment,
wherein the DNA-targeting segment: (i) comprises a nucleotide sequence that hybridizes to a target sequence of the DNA molecule, and (ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA,
wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in cleavage of the DNA molecule.
147 . The method of claim 146 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
148 . The method of claim 146 , wherein the Ca9 protein is fused to a heterologous polypeptide.
149 . The method of claim 146 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
150 . The method of claim 146 , wherein the nucleotide sequence that hybridizes to the target sequence is 15 nucleotides (nt) to 18 nt long.
151 . The method of claim 146 , wherein the nucleotide sequence that hybridizes to the target sequence is 18 nucleotides (nt) to 25 nt long.
152 . The method of claim 146 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
153 . The method of claim 146 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
154 . The method of claim 146 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
155 . The method of claim 146 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
156 . The method of claim 146 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
157 . The method of claim 146 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
158 . The method of claim 146 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
159 . The method of claim 146 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
160 . The method of claim 146 , wherein the DNA molecule is chromosomal DNA.
161 . A method of modifying a DNA molecule, cleaving a DNA molecule, and/or targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA that comprises:
an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
the targeter-RNA, which comprises a non-naturally occurring crRNA and hybridizes to a target sequence of the DNA molecule,
thereby modifying the DNA molecule, cleaving the DNA molecule, and/or targeting the Cas9 protein to the target sequence of the DNA molecule.
162 . The method of claim 161 , wherein said contacting results in modification of the DNA molecule.
163 . The method of claim 161 , wherein said contacting results in cleavage of the DNA molecule.
164 . The method of claim 163 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
165 . The method of claim 161 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
166 . The method of claim 161 , wherein the Ca9 protein is fused to a heterologous polypeptide.
167 . The method of claim 166 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
168 . The method of claim 161 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
169 . The method of claim 161 , wherein the target sequence is 15 nucleotides (nt) to 18 nt long.
170 . The method of claim 161 , wherein the target sequence is 18 nucleotides (nt) to 25 nt long.
171 . The method of claim 161 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
172 . The method of claim 161 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
173 . The method of claim 161 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
174 . The method of claim 161 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
175 . The method of claim 161 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
176 . The method of claim 161 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
177 . The method of claim 161 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
178 . The method of claim 161 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
179 . The method of claim 161 , wherein the DNA molecule is chromosomal DNA.
180 . The method of claim 161 , wherein said contacting comprises introducing into a cell containing the DNA molecule, one or more of:
the activator-RNA, or a nucleic acid encoding the activator-RNA; the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and the Cas9 protein, or a nucleic acid encoding the Cas9 protein.
181 . The method of claim 180 , wherein at least one of: the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein; is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
182 . The method of claim 180 , wherein the cell is a bacterial cell.
183 . The method of claim 180 , further comprising introducing into the cell a donor polynucleotide.
184 . The method of claim 180 , wherein (1) an isolated nucleic acid encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.
185 . The method of claim 180 , wherein an (1) mRNA encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.
186 . The method of claim 180 , wherein (1) an isolated nucleic acid encoding the Cas9 protein, and (2) one or more isolated nucleic acids encoding an activator-RNA and a targeter-RNA, are introduced into the cell.
187 . The method of claim 180 , wherein the Cas9 protein, an activator-RNA, and a targeter-RNA are introduced into the cell.
188 . A method of targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA that comprises:
an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
the targeter-RNA, which comprises a non-naturally occurring crRNA and hybridizes to a target sequence of the DNA molecule,
thereby targeting the Cas9 protein to the target sequence, wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell.
189 . The method of claim 188 , wherein said contacting results in modification of the DNA molecule.
190 . The method of claim 188 , wherein said contacting results in cleavage of the DNA molecule.
191 . The method of claim 190 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
192 . The method of claim 188 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
193 . The method of claim 188 , wherein the Ca9 protein is fused to a heterologous polypeptide.
194 . The method of claim 193 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
195 . The method of claim 188 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
196 . The method of claim 188 , wherein the target sequence is 15 nucleotides (nt) to 18 nt long.
197 . The method of claim 188 , wherein the target sequence is 18 nucleotides (nt) to 25 nt long.
198 . The method of claim 188 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
199 . The method of claim 188 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
200 . The method of claim 188 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
201 . The method of claim 188 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
202 . The method of claim 188 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
203 . The method of claim 188 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
204 . The method of claim 188 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
205 . The method of claim 188 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
206 . The method of claim 188 , wherein the DNA molecule is chromosomal DNA.
207 . A method of modifying a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA that comprises:
an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
the targeter-RNA, which comprises a non-naturally occurring crRNA and hybridizes to a target sequence of the DNA molecule,
wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in modification of the DNA molecule.
208 . The method of claim 207 , wherein said modification is cleavage of the DNA molecule.
209 . The method of claim 208 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
210 . The method of claim 207 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
211 . The method of claim 207 , wherein the Ca9 protein is fused to a heterologous polypeptide.
212 . The method of claim 211 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
213 . The method of claim 207 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
214 . The method of claim 207 , wherein the target sequence is 15 nucleotides (nt) to 18 nt long.
215 . The method of claim 207 , wherein the target sequence is 18 nucleotides (nt) to 25 nt long.
216 . The method of claim 207 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
217 . The method of claim 207 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
218 . The method of claim 207 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
219 . The method of claim 207 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
220 . The method of claim 207 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
221 . The method of claim 207 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
222 . The method of claim 207 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
223 . The method of claim 207 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
224 . The method of claim 207 , wherein the DNA molecule is chromosomal DNA.
225 . A method of cleaving a DNA molecule, the method comprising:
contacting a DNA molecule with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA that comprises:
an activator-RNA that hybridizes with a targeter-RNA to form a duplex that binds to the Cas9 protein, and
the targeter-RNA, which comprises a non-naturally occurring crRNA and hybridizes to a target sequence of the DNA molecule,
wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in cleavage of the DNA molecule.
226 . The method of claim 225 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
227 . The method of claim 225 , wherein the Ca9 protein is fused to a heterologous polypeptide.
228 . The method of claim 225 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
229 . The method of claim 225 , wherein the target sequence is 15 nucleotides (nt) to 18 nt long.
230 . The method of claim 225 , wherein the target sequence is 18 nucleotides (nt) to 25 nt long.
231 . The method of claim 225 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
232 . The method of claim 225 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
233 . The method of claim 225 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs.
234 . The method of claim 225 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
235 . The method of claim 225 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
236 . The method of claim 225 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
237 . The method of claim 225 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, where the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
238 . The method of claim 225 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
239 . The method of claim 225 , wherein the DNA molecule is chromosomal DNA.Join the waitlist — get patent alerts
Track US2018273981A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.