Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

1 - 2 . (canceled) 
     
     
         3 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:
 contacting a target DNA with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA comprising:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase,   
       wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified. 
     
     
         4 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:
 contacting a target DNA with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA comprising:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   wherein the targeter-RNA and/or the activator-RNA is conjugated to a heterologous moiety,   
       wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified. 
     
     
         5 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:
 contacting a target DNA with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA comprising:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   wherein the Cas9 protein is fused to a heterologous polypeptide,   
       wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified. 
     
     
         6 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:
 contacting a target DNA with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA comprising:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   wherein the Cas9 protein is covalently linked to a protein transduction domain,   
       wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified. 
     
     
         7 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:
 contacting a target DNA with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA comprising:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   wherein the target DNA is chromosomal DNA,   
       wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified. 
     
     
         8 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:
 contacting a target DNA with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA comprising:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   wherein said contacting comprises contacting a cell containing the target DNA, or introducing into the cell, a composition comprising:
 (1) the Cas9 protein, or a nucleic acid encoding the Cas9 protein; 
 (2) the DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA; and 
 (3) one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent, 
   
       wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified. 
     
     
         9 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:
 contacting a target DNA with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA comprising:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   
       wherein the method is characterized by one or more of:
 (A) the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase; 
 (B) the targeter-RNA and/or the activator-RNA is conjugated to a heterologous moiety; 
 (C) the Cas9 protein is fused to a heterologous polypeptide; 
 (D) the Cas9 protein is covalently linked to a protein transduction domain; 
 (E) the target DNA is chromosomal DNA; and 
 (F) the contacting comprises contacting a cell containing the target DNA, or introducing into the cell, a composition comprising:
 (1) the Cas9 protein, or a nucleic acid encoding the Cas9 protein; 
 (2) the DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA; and 
 (3) one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent, 
 
 wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified. 
 
     
     
         10 . The method of  claim 9 , wherein said contacting results in modification of the target DNA. 
     
     
         11 . The method of  claim 9 , wherein said contacting results in cleavage of the target DNA. 
     
     
         12 . The method of  claim 11 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA. 
     
     
         13 . The method of  claim 9 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 
     
     
         14 . The method of  claim 9 , wherein the Cas9 protein is fused to the heterologous polypeptide. 
     
     
         15 . The method of  claim 14 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity. 
     
     
         16 . The method of  claim 9 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to the protein transduction domain. 
     
     
         17 . The method of  claim 9 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15 nucleotides (nt) to 18 nt long. 
     
     
         18 . The method of  claim 9 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 18 nucleotides (nt) to 25 nt long. 
     
     
         19 . The method of  claim 9 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules. 
     
     
         20 . The method of  claim 9 , wherein the Cas9 protein is produced from a nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more nucleic acids encoding the DNA-targeting RNA. 
     
     
         21 . The method of  claim 9 , comprising contacting the target DNA with two or more different DNA-targeting RNAs. 
     
     
         22 . The method of  claim 9 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUUUUU (SEQ ID NO: 478). 
     
     
         23 . The method of  claim 9 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441). 
     
     
         24 . The method of  claim 9 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase. 
     
     
         25 . The method of  claim 9 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, wherein the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, and 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA). 
     
     
         26 . The method of  claim 9 , wherein the targeter-RNA and/or the activator-RNA is conjugated to the heterologous moiety, which is a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin. 
     
     
         27 . The method of  claim 9 , wherein the target DNA is chromosomal DNA. 
     
     
         28 . The method of  claim 9 , wherein said contacting comprises introducing into a cell containing the target DNA, one or more of:
 the activator-RNA, or a nucleic acid encoding the activator-RNA;   the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and   the Cas9 protein, or a nucleic acid encoding the Cas9 protein.   
     
     
         29 . The method of  claim 28 , wherein at least one of: the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein; is a plasmid, a cosmid, a minicircle, a phage, or a viral vector. 
     
     
         30 . The method of  claim 28 , wherein the cell is a bacterial cell. 
     
     
         31 . The method of  claim 28 , further comprising introducing into the cell a donor polynucleotide. 
     
     
         32 . The method of  claim 9 , wherein the DNA-targeting RNA comprises a protein-binding segment that has a length of 15 nucleotides to 80 nucleotides. 
     
     
         33 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a histone that is bound to a target DNA, the method comprising:
 contacting a target DNA with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA comprising:
 (i) a targeter-RNA, which has one DNA-targeting segment that comprises a nucleotide sequence that is complementary to a target sequence of the target DNA, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   
       wherein the method is characterized by one or more of:
 (A) the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase; 
 (B) the targeter-RNA and/or the activator-RNA is conjugated to a heterologous moiety; 
 (C) the Cas9 protein is fused to a heterologous polypeptide; 
 (D) the Cas9 protein is covalently linked to a protein transduction domain; 
 (E) the target DNA is chromosomal DNA; and 
 (F) the contacting comprises contacting a cell containing the target DNA, or introducing into the cell, a composition comprising:
 (1) the Cas9 protein, or a nucleic acid encoding the Cas9 protein; 
 (2) the DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA; and 
 (3) one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent, 
 
 
       wherein: the complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a histone that is bound to the target DNA is modified. 
     
     
         34 . A composition comprising:
 a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:   (a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and   (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,   wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule,   wherein the target DNA molecule is chromosomal DNA.   
     
     
         35 . A composition comprising:
 a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:   (a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and   (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,   wherein one or more of the targeter-RNA and the activator-RNA is conjugated to a heterologous moiety, or the one or more nucleic acids encoding the DNA-targeting RNA are conjugated to a heterologous moiety, and   wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.   
     
     
         36 . A composition comprising:
 a DNA-targeting RNA that comprises:   (a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and   (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,   wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase, and   wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.   
     
     
         37 . A composition comprising:
 (1) a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:
 (a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and 
 (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment; and 
   (2) one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent,
 wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule. 
   
     
     
         38 . A composition comprising:
 one or more nucleic acids encoding a DNA-targeting RNA, wherein the DNA-targeting RNA comprises:   (a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and   (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,   wherein the targeter-RNA or activator-RNA, or both, is encoded by a nucleotide sequence operably linked to a heterologous transcriptional control sequence and/or a heterologous translational control sequence,   wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.   
     
     
         39 . A composition comprising:
 a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:   (a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and   (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,   wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule,   wherein the composition is lyophilized.   
     
     
         40 . A composition comprising:
 a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:   (a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and   (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,   wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule, and   wherein the composition is characterized by one or more of:   
       (A) the target DNA molecule is chromosomal DNA; 
       (B) one or more of: the targeter-RNA, the activator-RNA, and the one or more nucleic acids encoding the DNA-targeting RNA, are conjugated to a heterologous moiety; 
       (C) the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase; 
       (D) the composition comprises one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent; 
       (E) the targeter-RNA or activator-RNA, or both, encoded by the one or more nucleic acids, is encoded by a nucleotide sequence operably linked to a heterologous transcriptional control sequence and/or a heterologous translational control sequence; and 
       (F) the composition is lyophilized. 
     
     
         41 . The composition of  claim 40 , further comprising a Cas9 protein, or a nucleic acid encoding the Cas9 protein. 
     
     
         42 . The composition of  claim 41 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA. 
     
     
         43 . The composition of  claim 41 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 
     
     
         44 . The composition of  claim 41 , wherein the Cas9 protein is fused to a heterologous polypeptide. 
     
     
         45 . The composition of  claim 44 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity. 
     
     
         46 . The composition of  claim 41 , wherein the Cas9 protein is covalently linked to a protein transduction domain. 
     
     
         47 . The composition of  claim 40 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA molecule is 15 nucleotides (nt) to 18 nt long. 
     
     
         48 . The composition of  claim 40 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA molecule is 18 nucleotides (nt) to 25 nt long. 
     
     
         49 . The composition of  claim 40 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules. 
     
     
         50 . The composition of  claim 40 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase. 
     
     
         51 . The composition of  claim 40 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, wherein the non-natural intemucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, and 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA). 
     
     
         52 . The composition of  claim 40 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety selected from: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; and a coumarin. 
     
     
         53 . The composition of  claim 40 , wherein the DNA molecule is chromosomal DNA. 
     
     
         54 . The composition of  claim 40 , wherein the DNA-targeting RNA comprises a protein-binding segment that has a length of 15 nucleotides to 80 nucleotides. 
     
     
         55 . A composition comprising:
 a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:   (a) a targeter-RNA, which has one DNA-targeting segment that comprises a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and   (b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment,   wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule, and   wherein the composition is characterized by one or more of:   
       (A) the target DNA molecule is chromosomal DNA; 
       (B) one or more of: the targeter-RNA, the activator-RNA, and the one or more nucleic acids encoding the DNA-targeting RNA, are conjugated to a heterologous moiety; 
       (C) the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural inteniucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase; 
       (D) the composition comprises one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent; 
       (E) the targeter-RNA or activator-RNA, or both, encoded by the one or more nucleic acids, is encoded by a nucleotide sequence operably linked to a heterologous transcriptional control sequence and/or a heterologous translational control sequence; and 
       (F) the composition is lyophilized. 
     
     
         56 . A cell comprising the composition of  claim 40 . 
     
     
         57 . The cell of  claim 56 , wherein the cell is a bacterial cell. 
     
     
         58 . A cell comprising the composition of  claim 41 . 
     
     
         59 . The cell of  claim 58  wherein the cell is a bacterial cell. 
     
     
         60 . A cell comprising a first nucleic acid comprising a nucleotide sequence that (i) encodes an activator-RNA, and (ii) is operably linked to an expression control sequence that is heterologous to the activator-RNA; wherein the first nucleic acid does not comprise a sequence that encodes a targeter-RNA. 
     
     
         61 . The cell of  claim 60 , further comprising a second nucleic acid comprising a nucleotide sequence that encodes a targeter-RNA. 
     
     
         62 . The cell of  claim 61 , further comprising a Cas9 protein or a nucleic acid encoding the Cas9 protein. 
     
     
         63 . A cell comprising:
 a first nucleic acid comprising a nucleotide sequence that (i) encodes an activator-RNA, and (ii) is operably linked to an expression control sequence that is heterologous to the activator-RNA; wherein the first nucleic acid does not comprise a sequence that encodes a targeter-RNA, and   a second nucleic acid comprising a nucleotide sequence that encodes a targeter-RNA that has one DNA-targeting segment.   
     
     
         64 . A cell comprising a nucleic acid comprising a nucleotide sequence that (i) encodes an activator-RNA, and (ii) is operably linked to an expression control sequence that is heterologous to the activator-RNA, wherein the expression control sequence is not operably linked to a nucleotide sequence that encodes a targeter-RNA. 
     
     
         65 . The cell of  claim 64 , further comprising a Cas9 protein or a nucleic acid encoding the Cas9 protein. 
     
     
         66 . The cell of  claim 64 , wherein the nucleic acid further comprises a nucleotide sequence that encodes a targeter-RNA. 
     
     
         67 . A cell comprising a nucleic acid comprising a nucleotide sequence that (i) encodes an activator-RNA, and (ii) is operably linked to an expression control sequence that is heterologous to the activator-RNA, wherein the expression control sequence is not operably linked to a nucleotide sequence that encodes a targeter-RNA, wherein the nucleic acid further comprises a nucleotide sequence that encodes a targeter-RNA that has one DNA-targeting segment. 
     
     
         68 . A cell comprising a vector comprising a recombinant nucleic acid consisting of a nucleotide sequence encoding an activator-RNA, wherein the nucleotide sequence encoding an activator-RNA is operably linked to a heterologous expression control sequence.