Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
Abstract
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
Claims
exact text as granted — not AI-modified1 - 2 . (canceled)
3 . A method of targeting and binding a target DNA, modifying a target DNA, modulating site-specific transcription from a target DNA, or modifying a polypeptide associated with a target DNA, the method comprising:
contacting a target DNA with an engineered non-naturally occurring complex comprising:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the target DNA, and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein,
wherein: the engineered non-naturally occurring complex binds to the target DNA, the target DNA is modified, the target DNA is cleaved, the target DNA is edited, transcription from the target DNA is modulated, and/or a polypeptide associated with the target DNA is modified.
4 . The method of claim 3 , wherein said contacting results in modification of the target DNA.
5 . The method of claim 3 , wherein said contacting results in cleavage of the target DNA.
6 . The method of claim 5 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA.
7 . The method of claim 3 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
8 . The method of claim 3 , wherein the Ca9 protein is fused to a heterologous polypeptide.
9 . The method of claim 8 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity.
10 . The method of claim 3 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain.
11 . The method of claim 3 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15 nucleotides (nt) to 18 nt long.
12 . The method of claim 3 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 18 nucleotides (nt) to 25 nt long.
13 . The method of claim 3 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules.
14 . The method of claim 3 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA.
15 . The method of claim 3 , comprising contacting the target DNA with two or more different DNA-targeting RNAs.
16 . The method of claim 3 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478).
17 . The method of claim 3 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
18 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase.
19 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, wherein the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA).
20 . The method of claim 3 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin.
21 . The method of claim 3 , wherein the target DNA is chromosomal DNA.
22 . The method of claim 3 , wherein said contacting comprises introducing into a cell containing the target DNA, one or more of:
the activator-RNA, or a nucleic acid encoding the activator-RNA; the targeter-RNA, or a nucleic acid encoding the targeter-RNA; and the Cas9 protein, or a nucleic acid encoding the Cas9 protein.
23 . The method of claim 22 , wherein at least one of: the nucleic acid encoding the activator-RNA, the nucleic acid encoding the targeter-RNA, and the nucleic acid encoding the Cas9 protein; is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
24 . The method of claim 22 , wherein the cell is a bacterial cell.
25 . The method of claim 22 , further comprising introducing into the cell a donor polynucleotide.
26 . The method of claim 22 , wherein (1) an isolated nucleic acid encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.
27 . The method of claim 22 , wherein an (1) mRNA encoding the Cas9 protein, (2) an activator-RNA, and (3) a targeter-RNA, are introduced into the cell.
28 . The method of claim 22 , wherein (1) an isolated nucleic acid encoding the Cas9 protein, and (2) one or more isolated nucleic acids encoding an activator-RNA and a targeter-RNA, are introduced into the cell.
29 . The method of claim 22 , wherein the Cas9 protein, an activator-RNA, and a targeter-RNA are introduced into the cell.
30 . The method of claim 3 , wherein the targeter-RNA is engineered such that the targeter-RNA comprises a first nucleotide sequence that: (1) is not found in naturally occurring crRNA, and (2) comprises the nucleotide sequence that is complementary to the target sequence of the target DNA.Join the waitlist — get patent alerts
Track US2018245101A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.