Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

1 - 2 . (canceled) 
     
     
         3 . A method of targeting a Cas9 protein to a target sequence of a DNA molecule, the method comprising:
 contacting a DNA molecule with a complex that comprises:
 (a) a Cas9 protein; and 
 (b) a DNA-targeting RNA that comprises:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the DNA molecule, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
 
   thereby targeting the Cas9 protein to the target sequence,   wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell.   
     
     
         4 . The method of  claim 3 , wherein said contacting results in modification of the DNA molecule. 
     
     
         5 . The method of  claim 3 , wherein said contacting results in cleavage of the DNA molecule. 
     
     
         6 . The method of  claim 5 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA. 
     
     
         7 . The method of  claim 3 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 
     
     
         8 . The method of  claim 3 , wherein the Cas9 protein is fused to a heterologous polypeptide. 
     
     
         9 . The method of  claim 8 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity. 
     
     
         10 . The method of  claim 3 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain. 
     
     
         11 . The method of  claim 3 , wherein the nucleotide sequence that is complementary to the target sequence is 15 nucleotides (nt) to 18 nt long. 
     
     
         12 . The method of  claim 3 , wherein the nucleotide sequence that is complementary to the target sequence is 18 nucleotides (nt) to 25 nt long. 
     
     
         13 . The method of  claim 3 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules. 
     
     
         14 . The method of  claim 3 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA. 
     
     
         15 . The method of  claim 3 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs. 
     
     
         16 . The method of  claim 3 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478). 
     
     
         17 . The method of  claim 3 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441). 
     
     
         18 . The method of  claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase. 
     
     
         19 . The method of  claim 3 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, wherein the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA). 
     
     
         20 . The method of  claim 3 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin. 
     
     
         21 . The method of  claim 3 , wherein the DNA molecule is chromosomal DNA. 
     
     
         22 . A method of modifying a DNA molecule, the method comprising:
 contacting a DNA molecule with a complex that comprises:   (a) a Cas9 protein; and   (b) a DNA-targeting RNA that comprises:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the DNA molecule, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in modification of the DNA molecule.   
     
     
         23 . The method of  claim 22 , wherein said modification is cleavage of the DNA molecule. 
     
     
         24 . The method of  claim 23 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA. 
     
     
         25 . The method of  claim 22 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain. 
     
     
         26 . The method of  claim 22 , wherein the Ca9 protein is fused to a heterologous polypeptide. 
     
     
         27 . The method of  claim 26 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain and has substantially no nuclease activity. 
     
     
         28 . The method of  claim 22 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain. 
     
     
         29 . The method of  claim 22 , wherein the nucleotide sequence that is complementary to the target sequence is 15 nucleotides (nt) to 18 nt long. 
     
     
         30 . The method of  claim 22 , wherein the nucleotide sequence that is complementary to the target sequence is 18 nucleotides (nt) to 25 nt long. 
     
     
         31 . The method of  claim 22 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules. 
     
     
         32 . The method of  claim 22 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA. 
     
     
         33 . The method of  claim 22 , comprising contacting the DNA molecule with two or more different DNA-targeting RNAs. 
     
     
         34 . The method of  claim 22 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478). 
     
     
         35 . The method of  claim 22 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441). 
     
     
         36 . The method of  claim 22 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase. 
     
     
         37 . The method of  claim 22 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, wherein the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA). 
     
     
         38 . The method of  claim 22 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin. 
     
     
         39 . The method of  claim 22 , wherein the DNA molecule is chromosomal DNA. 
     
     
         40 . A method of cleaving a DNA molecule, the method comprising:
 contacting a DNA molecule with a complex comprising:   (a) a Cas9 protein, and   (b) a DNA-targeting RNA that comprises:
 (i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of the DNA molecule, and 
 (ii) an activator-RNA that hybridizes with the targeter-RNA to form a duplex that binds to the Cas9 protein, 
   wherein said contacting occurs outside of a bacterial cell and outside of an archaeal cell, and wherein said contacting results in cleavage of the DNA molecule.   
     
     
         41 . The method of  claim 40 , wherein the Cas9 protein comprises a mutation in a RuvC domain or an HNH domain and can cleave only one strand of DNA. 
     
     
         42 . The method of  claim 40 , wherein the Ca9 protein is fused to a heterologous polypeptide. 
     
     
         43 . The method of  claim 40 , wherein the Cas9 protein is covalently linked, at its N- or C-terminus, to a protein transduction domain. 
     
     
         44 . The method of  claim 40 , wherein the nucleotide sequence that is complementary to the target sequence is 15 nucleotides (nt) to 18 nt long. 
     
     
         45 . The method of  claim 40 , wherein the nucleotide sequence that is complementary to the target sequence is 18 nucleotides (nt) to 25 nt long. 
     
     
         46 . The method of  claim 40 , wherein the DNA-targeting RNA is a double-molecule DNA-targeting RNA such that said targeter-RNA and said activator-RNA are present on different RNA molecules. 
     
     
         47 . The method of  claim 40 , wherein the Cas9 protein is produced from a first nucleic acid encoding the Cas9 protein; and the DNA-targeting RNA is produced from one or more second nucleic acids encoding the DNA-targeting RNA. 
     
     
         48 . The method of  claim 40 , comprising contacting the DNA molecule with more different DNA-targeting RNAs. 
     
     
         49 . The method of  claim 40 , wherein the activator-RNA comprises the 75 nucleotide tracrRNA sequence AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 478). 
     
     
         50 . The method of  claim 40 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441). 
     
     
         51 . The method of  claim 40 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, a modified backbone, and a modified nucleobase. 
     
     
         52 . The method of  claim 40 , wherein the targeter-RNA and/or the activator-RNA comprises one or more of: (i) a non-natural internucleoside linkage, wherein the non-natural internucleoside linkage is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); (iii) a modified sugar moiety, wherein the modified sugar moiety is 2′-O-methoxyethyl, 2′-O-methyl, 2′-O-(2-methoxyethyl), 2′-fluoro, 2′-dimethylaminooxyethoxy, or 2′-dimethylaminoethoxyethoxy; (iv) a peptide nucleic acid (PNA); (v) a morpholino nucleic acid; and (vi) a cyclohexenyl nucleic acid (CeNA). 
     
     
         53 . The method of  claim 40 , wherein the targeter-RNA and/or the activator-RNA is conjugated to a moiety, wherein the moiety is: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; or a coumarin. 
     
     
         54 . The method of  claim 40 , wherein the DNA molecule is chromosomal DNA.