Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

1 - 2 . (canceled) 
     
     
         3 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (A) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex comprising:
 (i) a Cas9 protein; 
 (ii) an activator-RNA that hybridizes with a targeter-RNA to form a duplex, of a DNA-targeting RNA, that binds to the Cas9 protein; and 
 (iii) the targeter-RNA, comprising:
 (a) a first nucleotide sequence that is complementary to a target sequence of the target DNA molecule, and is not found in naturally occurring crRNA; and 
 (b) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex, 
 
 wherein said assembling comprises combining (i), (ii), and (iii) under conditions suitable for formation of the DNA-targeting RNA/polypeptide complex; and 
   (B) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         4 . The method of  claim 3 , wherein the nucleotide sequence of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long. 
     
     
         5 . The method of  claim 3 , wherein the nucleotide sequence, of the targeter-RNA that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long. 
     
     
         6 . The method of  claim 5 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the nucleotide sequence that is complementary to the target sequence of the target DNA molecule. 
     
     
         7 . The method of  claim 3 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         8 . The method of  claim 3 , wherein, prior to assembly of the DNA-targeting RNA/polypeptide complex, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         9 . The method of  claim 8 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         10 . The method of  claim 9 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         11 . The method of  claim 8 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         12 . The method of  claim 11 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         13 . The method of  claim 11 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         14 . The method of  claim 3 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41. 
     
     
         15 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (1) incubating, in vitro outside of a cell, a targeter-RNA with an activator-RNA to form a DNA-targeting RNA,
 wherein the targeter-RNA and the activator-RNA hybridize with one another to form a duplex and the targeter-RNA comprises:
 (a) a first nucleotide sequence that is complementary to a target sequence of the target DNA molecule, and is not found in naturally occurring crRNA; and 
 (b) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex; 
 
   (2) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex by combining the DNA-targeting RNA with a Cas9 protein, wherein the DNA-targeting RNA/polypeptide complex comprises the Cas9 protein, the targeter-RNA, and the activator-RNA; and   (3) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         16 . The method of  claim 15 , wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long. 
     
     
         17 . The method of  claim 15 , wherein the nucleotide sequence, of the targeter-RNA, that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long. 
     
     
         18 . The method of  claim 15 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the nucleotide sequence that is complementary to the target sequence of the target DNA molecule. 
     
     
         19 . The method of  claim 15 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         20 . The method of  claim 15 , wherein, prior to said incubating, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and prior to said assembling, the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         21 . The method of  claim 20 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         22 . The method of  claim 21 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         23 . The method of  claim 21 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         24 . The method of  claim 23 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         25 . The method of  claim 23 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         26 . The method of  claim 15 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41. 
     
     
         27 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (A) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex comprising:
 (i) a Cas9 protein; 
 (ii) an activator-RNA that hybridizes with a targeter-RNA to form a duplex, of a DNA-targeting RNA, that binds to the Cas9 protein; and 
 (iii) the targeter-RNA, comprising:
 (a) a first nucleotide sequence that is not found in naturally occurring crRNA and that comprises a sequence that is complementary to a target sequence of the target DNA molecule; and 
 (b) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex, 
 
 wherein said assembling comprises combining (i), (ii), and (iii) under conditions suitable for formation of the DNA-targeting RNA/polypeptide complex; and 
   (B) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         28 . The method of  claim 27 , wherein the sequence that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long. 
     
     
         29 . The method of  claim 27 , wherein the sequence that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long. 
     
     
         30 . The method of  claim 29 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the sequence that is complementary to the target sequence of the target DNA molecule. 
     
     
         31 . The method of  claim 27 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         32 . The method of  claim 27 , wherein, prior to assembly of the DNA-targeting RNA/polypeptide complex, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         33 . The method of  claim 32 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         34 . The method of  claim 33 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         35 . The method of  claim 32 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         36 . The method of  claim 35 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         37 . The method of  claim 35 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         38 . The method of  claim 27 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41. 
     
     
         39 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (1) incubating, in vitro outside of a cell, a targeter-RNA with an activator-RNA to form a DNA-targeting RNA,
 wherein the targeter-RNA and the activator-RNA hybridize with one another to form a duplex and the targeter-RNA comprises:
 (a) a first nucleotide sequence that is not found in naturally occurring crRNA and that comprises a sequence that is complementary to a target sequence of the target DNA molecule; and 
 (b) a second nucleotide sequence that hybridizes with the activator-RNA to form said duplex; 
 
   (2) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex by combining the DNA-targeting RNA with a Cas9 protein, wherein the DNA-targeting RNA/polypeptide complex comprises the Cas9 protein, the targeter-RNA, and the activator-RNA; and   (3) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         40 . The method of  claim 39 , wherein the sequence that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long. 
     
     
         41 . The method of  claim 39 , wherein the sequence that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long. 
     
     
         42 . The method of  claim 39 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the sequence that is complementary to the target sequence of the target DNA molecule. 
     
     
         43 . The method of  claim 39 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         44 . The method of  claim 39 , wherein, prior to said incubating, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and prior to said assembling, the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         45 . The method of  claim 44 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         46 . The method of  claim 45 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         47 . The method of  claim 45 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         48 . The method of  claim 47 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         49 . The method of  claim 47 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         50 . The method of  claim 39 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41. 
     
     
         51 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (A) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex comprising:
 (i) a Cas9 protein; 
 (ii) an activator-RNA that hybridizes with a targeter-RNA to form a duplex, of a DNA-targeting RNA, that binds to the Cas9 protein; and 
 (iii) the targeter-RNA, comprising:
 (a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and 
 (b) a DNA-targeting segment that is fused to and positioned 5′ of the duplex-forming segment, wherein the DNA-targeting segment (1) comprises a sequence that is complementary to a target sequence of the target DNA molecule, and (2) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA, 
 
 wherein said assembling comprises combining (i), (ii), and (iii) under conditions suitable for formation of the DNA-targeting RNA/polypeptide complex; and 
   (B) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         52 . The method of  claim 51 , wherein the sequence that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long. 
     
     
         53 . The method of  claim 51 , wherein the sequence that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long. 
     
     
         54 . The method of  claim 53 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the sequence that is complementary to the target sequence of the target DNA molecule. 
     
     
         55 . The method of  claim 51 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         56 . The method of  claim 51 , wherein, prior to assembly of the DNA-targeting RNA/polypeptide complex, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         57 . The method of  claim 56 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         58 . The method of  claim 57 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         59 . The method of  claim 56 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         60 . The method of  claim 59 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         61 . The method of  claim 59 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         62 . The method of  claim 51 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41. 
     
     
         63 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (1) incubating, in vitro outside of a cell, a targeter-RNA with an activator-RNA to form a DNA-targeting RNA, wherein the targeter-RNA and the activator-RNA hybridize with one another to form a duplex, and the targeter-RNA comprises:
 (a) a duplex-forming segment that hybridizes with the activator-RNA to form said duplex, and 
 (b) a DNA-targeting segment that is fused to and positioned 5′ of the duplex-forming segment, 
 wherein the DNA-targeting segment: (i) comprises a sequence that is complementary to a target sequence of the target DNA molecule, and (ii) is heterologous to the duplex-forming segment such that the targeter-RNA has a nucleotide sequence that is not found in naturally occurring crRNA; 
   (2) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex by combining the DNA-targeting RNA with a Cas9 protein, wherein the DNA-targeting RNA/polypeptide complex comprises the Cas9 protein, the targeter-RNA, and the activator-RNA; and   (3) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the DNA-targeting RNA guides the DNA-targeting RNA/polypeptide complex to the target sequence of the target DNA molecule, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         64 . The method of  claim 63 , wherein the sequence that is complementary to the target sequence of the target DNA molecule is about 20 nucleotides long. 
     
     
         65 . The method of  claim 63 , wherein the sequence that is complementary to the target sequence of the target DNA molecule is 18 to 25 nucleotides long. 
     
     
         66 . The method of  claim 63 , wherein the targeter-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568) which is positioned 3′ of the sequence that is complementary to the target sequence of the target DNA molecule. 
     
     
         67 . The method of  claim 63 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         68 . The method of  claim 63 , wherein, prior to said incubating, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and prior to said assembling, the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         69 . The method of  claim 68 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         70 . The method of  claim 69 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         71 . The method of  claim 69 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         72 . The method of  claim 71 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         73 . The method of  claim 71 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         74 . The method of  claim 63 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41. 
     
     
         75 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (A) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex comprising:
 (i) a Cas9 protein; 
 (ii) an activator-RNA that hybridizes with a targeter-RNA to form a duplex, of a DNA-targeting RNA, that binds to the Cas9 protein; and 
 (iii) the targeter-RNA, comprising a non-naturally occurring crRNA, wherein said assembling comprises combining (i), (ii), and (iii) under conditions suitable for formation of the DNA-targeting RNA/polypeptide complex; and 
   (B) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the targeter-RNA of the DNA-targeting RNA hybridizes to a target sequence of the target DNA molecule, thereby guiding the DNA-targeting RNA/polypeptide complex to the target sequence, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         76 . The method of  claim 75 , wherein the target sequence is about 20 nucleotides long. 
     
     
         77 . The method of  claim 75 , wherein the target sequence is 18 to 25 nucleotides long. 
     
     
         78 . The method of  claim 77 , wherein a region of the targeter-RNA that hybridizes with the activator-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568), which is positioned 3′ of where the targeter-RNA hybridizes to the target sequence of the target DNA molecule. 
     
     
         79 . The method of  claim 75 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         80 . The method of  claim 75 , wherein, prior to assembly of the DNA-targeting RNA/polypeptide complex, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         81 . The method of  claim 80 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         82 . The method of  claim 81 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         83 . The method of  claim 80 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         84 . The method of  claim 83 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         85 . The method of  claim 83 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         86 . The method of  claim 75 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41. 
     
     
         87 . A method for site-specific modification of a target DNA molecule, the method comprising:
 (1) incubating, in vitro outside of a cell, a targeter-RNA with an activator-RNA to form a DNA-targeting RNA,
 wherein the targeter-RNA and the activator-RNA hybridize with one another to form a duplex and the targeter-RNA comprises a non-naturally occurring crRNA; 
   (2) assembling, in vitro outside of a cell, a DNA-targeting RNA/polypeptide complex by combining the DNA-targeting RNA with a Cas9 protein, wherein the DNA-targeting RNA/polypeptide complex comprises the Cas9 protein, the targeter-RNA, and the activator-RNA; and   (3) contacting the target DNA molecule with the DNA-targeting RNA/polypeptide complex,   wherein the targeter-RNA of the DNA-targeting RNA hybridizes to a target sequence of the target DNA molecule, thereby guiding the DNA-targeting RNA/polypeptide complex to the target sequence, and   wherein said site-specific modification of the target DNA molecule is cleavage of the target DNA molecule.   
     
     
         88 . The method of  claim 87 , wherein the targeter-RNA hybridizes to the target sequence of the target DNA molecule over a stretch of about 20 nucleotides. 
     
     
         89 . The method of  claim 87 , wherein the targeter-RNA hybridizes to the target sequence of the target DNA molecule over a stretch of 18 to 25 nucleotides. 
     
     
         90 . The method of  claim 87 , wherein a region of the targeter-RNA that hybridizes with the activator-RNA comprises the 22 nucleotide sequence guuuuagagcuaugcuguuuug (SEQ ID No: 568), which is positioned 3′ of where the targeter-RNA hybridizes to the target sequence of the target DNA molecule. 
     
     
         91 . The method of  claim 87 , wherein the Cas9 protein cleaves only one strand of DNA and comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
         92 . The method of  claim 87 , wherein, prior to said incubating, the targeter-RNA and the activator-RNA are produced by in vitro transcription or chemical synthesis; and prior to said assembling, the Cas9 protein is produced from a recombinant expression vector or by in vitro synthesis. 
     
     
         93 . The method of  claim 92 , wherein the Cas9 protein, is produced from a recombinant expression vector in a genetically modified prokaryotic host cell. 
     
     
         94 . The method of  claim 93 , wherein the Cas9 protein is purified from a lysate of the genetically modified prokaryotic host cell. 
     
     
         95 . The method of  claim 93 , wherein the Cas9 protein, the targeter-RNA, and the activator-RNA are each produced from one or more recombinant expression vectors in a genetically modified prokaryotic host cell. 
     
     
         96 . The method of  claim 95 , wherein the genetically modified prokaryotic host cell is produced by introducing at least one plasmid encoding the Cas9 protein, the targeter-RNA, and the activator-RNA into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         97 . The method of  claim 95 , wherein the genetically modified prokaryotic host cell is produced by introducing plasmids, each encoding one of the Cas9 protein, the targeter-RNA, and the activator-RNA, into a prokaryotic cell to result in the genetically modified prokaryotic host cell. 
     
     
         98 . The method of  claim 87 , wherein the Cas9 protein comprises the amino acid sequence set forth as SEQ ID NO: 41.