US2018187262A1PendingUtilityA1

Method for diagnosing a neurodegenerative disease

Assignee: UNIV MANCHESTERPriority: Aug 31, 2011Filed: Dec 29, 2017Published: Jul 5, 2018
Est. expiryAug 31, 2031(~5.1 yrs left)· nominal 20-yr term from priority
G01N 33/502C12Q 2600/136C12Q 2600/16C12Q 1/6883C12Q 2600/106C12Q 2600/156G01N 2333/47C12Q 2600/158G01N 33/6896A61K 38/1709G01N 2800/2835G01N 33/5088G01N 2800/2814
51
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present disclosure relates to methods of assessing whether a subject has or is likely to develop a neurodegenerative disease including determining whether the subject has a mutation in the C9orf72 gene, wherein said mutation prevents or disrupts C9orf72 expression relative to expression in a reference from subjects without the mutation.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
         1 . A method of detecting a hexanucleotide repeat GGCCCC or GGGGCC in the C9orf72 gene or mRNA, the method comprising:
 obtaining a sample from a subject;   mixing the sample with a forward primer and a reverse primer, the reverse primer including a GGGGCC repeat region and an anchor region that includes a nucleic acid sequence that flanks the hexanucleotide repeat; and   amplifying and detecting the hexanucleotide repeat starting at position 27,573,527 (coordinate taken from GRCh37/Hg19, forward strand).   
     
     
         2 . The method of  claim 1 , wherein mixing further includes an anchor primer that is a reverse primer that flanks the hexanucleotide repeat. 
     
     
         3 . The method of  claim 1 , wherein at least one of:
 the forward primer has a nucleic acid sequence comprising AGTCGCTAGAGGCGAAAGC (SEQ ID NO: 4);   the reverse primer has a nucleic acid sequence comprising TACGCATCCCAGTTTGAGACGGGGGCCGGGGCCGGGGCCGGGG (SEQ ID NO: 5);   the anchor primer has a nucleic acid sequence comprising TACGCATCCCAGTTTGAGACG (SEQ ID No: 6); or   a combination thereof.   
     
     
         4 . The method of  claim 1 , wherein amplifying and detecting the hexanucleotide repeat is performed with polymerase chain reaction, repeat-primed polymerase chain reaction, quantitative polymerase chain reaction, sequence specific oligonucleotide hybridization, reference strand medicated conformational analysis, Southern blotting, heteroduplex conformation polymorphism, single-stranded conformation polymorphism, reference strand-mediated conformational analysis, sequence based typing, nucleic acid sequencing, or a combination thereof. 
     
     
         5 . The method of  claim 1 , wherein at least one of mixing, amplifying, detecting, or a combination thereof includes contacting the sample with a labeled nucleic acid oligonucleotide having a nucleic acid sequence comprising GGCCCCGGCCCC (SEQ ID NO: 13) or GGGGCCGGGGCC (SEQ ID NO: 14). 
     
     
         6 . The method of  claim 5 , wherein the nucleic acid sequence of the labeled nucleic acid oligonucleotide comprises GGCCCCGGCCCCGGCCCC (SEQ ID NO: 15) or GGGGCCGGGGCCGGGGCC(SEQ ID NO: 16). 
     
     
         7 . The method of  claim 5 , wherein the nucleic acid sequence of the labeled nucleic acid oligonucleotide comprises GGCCCCGGCCCCGGCCCCGGCC (SEQ ID NO: 7). 
     
     
         8 . The method of  claim 5 , wherein detecting the hexanucleotide repeat includes detecting in the C9orf72 gene the hybridization of the labeled nucleic acid oligonucleotide to the hexanucleotide repeat. 
     
     
         9 . The method of  claim 8 , wherein the hybridization of the labeled nucleic acid oligonucleotide is detected by polymerase chain reaction, quantitative polymerase chain reaction, sequence specific oligonucleotide hybridization, reference strand mediated conformational analysis, Southern blotting, or a combination thereof. 
     
     
         10 . A method of diagnosing a subject as having or at increased risk of developing Frontotemporal Lobar Degeneration (FTLD) or Motor Neuron Disease (MND)/Amyotrophic Lateral Sclerosis (ALS), the method comprising:
 obtaining a sample from a subject;   mixing the sample with a forward primer and a reverse primer, the reverse primer including a GGGGCC repeat region and an anchor region that includes a nucleic acid sequence that flanks the hexanucleotide repeat;   amplifying and detecting the hexanucleotide repeat starting at position 27,573,527 (coordinate taken from GRCh37/Hg19, forward strand); and   diagnosing a subject as having or at increased risk for developing at least one of FTLD, MND/ALS, or a combination thereof, when at least 30 hexanucleotide repeats are detected in a sample obtained from the subject.   
     
     
         11 . The method of  claim 10 , wherein mixing further includes an anchor primer that is a reverse primer that flanks the hexanucleotide repeat. 
     
     
         12 . The method of  claim 10 , wherein at least one of:
 the forward primer has a nucleic acid sequence comprising AGTCGCTAGAGGCGAAAGC (SEQ ID NO: 4);   the reverse primer has a nucleic acid sequence comprising TACGCATCCCAGTTTGAGACGGGGGCCGGGGCCGGGGCCGGGG (SEQ ID NO: 5);   the anchor primer has a nucleic acid sequence comprising TACGCATCCCAGTTTGAGACG (SEQ ID No: 6); or   a combination thereof.   
     
     
         13 . The method of  claim 10 , wherein amplifying and detecting the hexanucleotide repeat is performed with polymerase chain reaction, repeat-primed polymerase chain reaction, quantitative polymerase chain reaction, sequence specific oligonucleotide hybridization, reference strand medicated conformational analysis, Southern blotting, heteroduplex conformation polymorphism, single-stranded conformation polymorphism, reference strand-mediated conformational analysis, sequence based typing, nucleic acid sequencing, or a combination thereof. 
     
     
         14 . The method of  claim 10 , wherein at least one of mixing, amplifying, detecting, or a combination thereof includes contacting the sample with a labeled nucleic acid oligonucleotide having a nucleic acid sequence comprising GGCCCCGGCCCC (SEQ ID NO: 13) or GGGGCCGGGGCC (SEQ ID NO: 14). 
     
     
         15 . The method of  claim 14 , wherein the nucleic acid sequence of the labeled nucleic acid oligonucleotide comprises GGCCCCGGCCCCGGCCCC (SEQ ID NO: 15) or GGGGCCGGGGCCGGGGCC(SEQ ID NO: 16). 
     
     
         16 . The method of  claim 14 , wherein the nucleic acid sequence of the labeled nucleic acid oligonucleotide comprises GGCCCCGGCCCCGGCCCCGGCC (SEQ ID NO: 7). 
     
     
         17 . The method of  claim 14 , wherein detecting the hexanucleotide repeat includes detecting in the C9orf72 gene the hybridization of the labeled nucleic acid oligonucleotide to the hexanucleotide repeat, wherein increased binding of the nucleic acid oligonucleotide is indicative of a subject having the hexanucleotide repeat. 
     
     
         18 . The method of  claim 17 , wherein the hybridization of the labeled nucleic acid oligonucleotide is detected by polymerase chain reaction, quantitative polymerase chain reaction, sequence specific oligonucleotide hybridization, reference strand mediated conformational analysis, Southern blotting, or a combination thereof. 
     
     
         19 . The method of  claim 10 , wherein the subject that has or is at increased risk of developing FTLD, MND/ALS or a combination thereof has at least 100 repeat copies of the hexanucleotide. 
     
     
         20 . The method of  claim 10 , wherein the subject that has or is at increased risk of developing FTLD, MND/ALS or a combination thereof has at least 500 repeat copies of the hexanucleotide. 
     
     
         21 . The method of  claim 10 , wherein the subject that has or is at increased risk of developing FTLD, MND/ALS or a combination thereof has at least 600 repeat copies of the hexanucleotide. 
     
     
         22 . The method of  claim 10 , wherein the subject that has or is at increased risk of developing FTLD, MND/ALS or a combination thereof has at least 700 repeat copies of the hexanucleotide. 
     
     
         23 . The method of  claim 10 , wherein the subject that has or is at increased risk of developing FTLD, MND/ALS or a combination thereof has at least 1,000 repeat copies of the hexanucleotide. 
     
     
         24 . The method of  claim 10 , wherein the FTLD is frontotemporal dementia (FTD) or FTLD with motor neuron disease/amyotrophic lateral sclerosis (MND/ALS). 
     
     
         25 . The method of  claim 10 , further comprising administering to the subject diagnosed as having or at increased risk of developing FLD, MND/ALS, or a combination thereof an effective amount of a therapeutic agent selected from (1) a C9orf72 protein or an active fragment thereof, (2) an agent that promotes or mimics C9orf72 activity, (3) a nucleic acid encoding C9orf72, or (4) an antisense agent comprising an oligonucleotide that is complementary to a portion of the mutant C9orf72, wherein the therapeutic agent is effective at ameliorating at least one symptom of FTLD, MND/ALS, or a combination thereof. 
     
     
         26 . A method of diagnosing a subject having or at increased risk of developing Frontotemporal Lobar Degeneration (FTLD) or Motor Neuron Disease (MND)/Amyotrophic Lateral Sclerosis (ALS), the method comprising:
 obtaining a sample from a subject;   mixing the sample with a labeled nucleic acid oligonucleotide having a nucleic acid sequence comprising GGCCCCGGCCCC (SEQ ID NO: 13) or GGGGCCGGGGCC (SEQ ID NO: 14);   detecting in the C9orf72 gene the hybridization of the labeled nucleic acid oligonucleotide to the hexanucleotide repeat starting at position 27,573,527 (coordinate taken from GRCh37/Hg19, forward strand), wherein increased binding of the nucleic acid oligonucleotide is indicative of a subject having the hexanucleotide repeat; and   diagnosing a subject as having or at increased risk for developing at least one of FTLD, MND/ALS, or a combination thereof, when at least 30 hexanucleotide repeats are detected in a sample obtained from the subject.   
     
     
         27 . The method of  claim 26 , further comprising administering to the subject diagnosed as having or at increased risk of developing FLD, MND/ALS, or a combination thereof an effective amount of a therapeutic agent selected from (1) a C9orf72 protein or an active fragment thereof, (2) an agent that promotes or mimics C9orf72 activity, (3) a nucleic acid encoding C9orf72, or (4) an antisense agent comprising an oligonucleotide that is complementary to a portion of the mutant C9orf72, wherein the therapeutic agent is effective at ameliorating at least one symptom of FTLD, MND/ALS, or a combination thereof. 
     
     
         28 . The method of  claim 26 , wherein the nucleic acid sequence comprises GGCCCCGGCCCCGGCCCC (SEQ ID NO: 15), GGGGCCGGGGCCGGGGCC(SEQ ID NO: 16), or GGCCCCGGCCCCGGCCCCGGCC (SEQ ID NO: 7). 
     
     
         29 . A method of treating a subject having or at increased risk of developing Frontotemporal Lobar Degeneration (FTLD) or Motor Neuron Disease (MND)/Amyotrophic Lateral Sclerosis (ALS), the method comprising:
 providing a patient identified as having at least 30 hexanucleotide repeats in the C9orf72 gene; and   treating the subject with an effective amount of a therapeutic agent selected from (1) a C9orf72 protein or an active fragment thereof, (2) an agent that promotes or mimics C9orf72 activity, (3) a nucleic acid encoding C9orf72, or (4) an antisense agent comprising an oligonucleotide that is complementary to a portion of the mutant C9orf72, wherein the therapeutic agent is effective at ameliorating at least one symptom of FTLD, MND/ALS, or a combination thereof.

Join the waitlist — get patent alerts

Track US2018187262A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.