US2017292125A1PendingUtilityA1

Multiple exon skipping compositions for dmd

Assignee: SAREPTA THERAPEUTICS INCPriority: Oct 24, 2008Filed: Nov 11, 2016Published: Oct 12, 2017
Est. expiryOct 24, 2028(~2.2 yrs left)· nominal 20-yr term from priority
A61P 21/00A61P 21/04C12N 15/111C12N 2310/331C12N 2320/33C12N 2310/3233C12N 2310/3341C12N 2310/11C12N 2320/30C12N 15/113C12N 2310/321C12N 2310/3513A61K 48/00
66
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.

Claims

exact text as granted — not AI-modified
1 - 65 . (canceled) 
     
     
         66 . An antisense oligonucleotide of formula (I): 
       
         
           
           
               
               
           
         
       
       or a pharmaceutically acceptable salt thereof, wherein:
 Z is 19; 
 R is H or —C(O)CH 3 , and 
 each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of TGTTGCCTCCGGTTCTGAAGGTGTTCTIGT (SEQ ID NO: 631), and 
 wherein the antisense oligonucleotide induces exon 53 skipping. 
 
     
     
         67 . A pharmaceutical composition comprising an antisense oligonucleotide of formula (I): 
       
         
           
           
               
               
           
         
       
       or a pharmaceutically acceptable salt thereof, wherein:
 Z is 19; 
 R is H or —C(O)CH 3 , and 
 each B is adenine, guanine, thymine, or cytosine, which taken together form a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA, wherein the base sequence comprises 21 consecutive bases of TGTTGCCTCCGGTTCTGAAGGTGTTCTIGT (SEQ ID NO: 631), and 
 wherein the antisense oligonucleotide induces exon 53 skipping.

Join the waitlist — get patent alerts

Track US2017292125A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.