Ammonia-oxidizing nitrosomonas eutropha strain d23

Abstract

This disclosure provides, inter alia, an optimized strain of Nitrosomonas eutropha ( N. eutropha ) designated D23, D23-100, or AOB D23-100. N. eutropha bacteria disclosed in this application have desirable properties, e.g., optimized properties, such as the ability to suppress growth of pathogenic bacteria, and an enhanced ability to produce nitric oxide and nitric oxide precursors. The N. eutropha herein may be used, for instance, to treat diseases associated with low nitrite levels, skin diseases, and diseases caused by pathogenic bacteria.

What is claimed is: 
     
         1 . A purified preparation of optimized  Nitrosomonas eutropha  ( N. eutropha ) bacterium having at least one property selected from:
 an optimized growth rate;   an optimized NH 4   +  oxidation rate; and   an optimized resistance to NH 4   + .   
     
     
         2 . The preparation of  N. eutropha  bacterium of  claim 1 , wherein the optimized growth rate is a rate allowing a continuous culture of  N. eutropha  at an OD600 (optical density at 600 nm) of about 0.15-0.18 to reach an OD600 of about 0.5-0.6 in about 1-2 days. 
     
     
         3 . The preparation of  N. eutropha  bacterium of  claim 1  or  2 , wherein the optimized growth rate is a doubling time of about 8 hours when cultured under batch culture conditions. 
     
     
         4 . The preparation of  N. eutropha  bacterium of any of  claims 1 - 3 , wherein the optimized NH 4   +  oxidation rate is a rate of at least about 125 micromoles per minute of oxidizing NH 4   +  to NO 2   − . 
     
     
         5 . The preparation of  N. eutropha  bacterium of any of  claims 1 - 4 , wherein the optimized resistance to NH 4   +  is an ability to grow in medium comprising about 200 mM NH 4   +  for at least about 48 hours. 
     
     
         6 . The preparation of  N. eutropha  bacterium of any of  claims 1 - 5 , which has at least two properties selected from an optimized growth rate, an optimized NH 4   +  oxidation rate, and an optimized resistance to NH 4   + . 
     
     
         7 . The preparation of  N. eutropha  bacterium of  claim 1 - 6 , which has an optimized growth rate, an optimized NH 4   +  oxidation rate, and an optimized resistance to NH 4   + . 
     
     
         8 . The preparation of  N. eutropha  bacterium of any of  claims 1 - 7 , which comprises a chromosome that hybridizes under very high stringency to SEQ ID NO: 1. 
     
     
         9 . The preparation of  N. eutropha  bacterium of any of  claim 1 - 8 , which comprises an AmoA protein having an identity to SEQ ID NO: 6 or 12 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical, an AmoB protein having an identity to SEQ ID NO: 8 or 14 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical, an amoC gene having an identity to SEQ ID NO: 4, 10, or 16 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical, a hydroxylamine oxidoreductase protein having an identity to SEQ ID NO: 18, 20, or 22 selected from at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical, a cytochrome c554 protein having an identity to SEQ ID NO: 24, 26, or 28 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical, or a cytochrome c M 552 protein having an identity to SEQ ID NO: 30 or 32 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical. 
     
     
         10 . The preparation of  N. eutropha  bacterium of any of  claims 1 - 9 , which comprises 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, or all of the sequence characteristics of Table 2. 
     
     
         11 . The preparation of  N. eutropha  bacterium of  claim 10 , which comprises an AmoA1 or AmoA2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 1, e.g., a V at position 1. 
     
     
         12 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 11 , which comprises an AmoA1 or AmoA2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 160, e.g., an L at position 160. 
     
     
         13 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 12 , which comprises an AmoA1 or AmoA2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 167, e.g., an A at position 167. 
     
     
         14 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 13 , which comprises an AmoB1 or AmoB2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 33, e.g., a V at position 33. 
     
     
         15 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 14 , which comprises an AmoB1 or AmoB2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 165, e.g., an I at position 165. 
     
     
         16 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 15 , which comprises an AmoC3 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 79, e.g., an A at position 79. 
     
     
         17 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 16 , which comprises an AmoC3 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 271, e.g., a V at position 271. 
     
     
         18 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 17 , which comprises a Hao1, Hao2, or Hao3 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 85, e.g., an S at position 85. 
     
     
         19 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 18 , which comprises a Hao1, Hao2, or Hao3 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 312, e.g., an E at position 312. 
     
     
         20 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 19 , which comprises a Hao1 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 163, e.g., an A at position 163. 
     
     
         21 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 20 , which comprises a c554 CycA1, c554 CycA2, or c554 CycA3 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 65, e.g., a T at position 65. 
     
     
         22 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 21 , which comprises a c554 CycA1 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 186, e.g., a T at position 186. 
     
     
         23 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 22 , which comprises a c M 552 CycB1 or c M 552 CycB2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 63, e.g., a V at position 63. 
     
     
         24 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 23 , which comprises a c M 552 CycB1 or c M 552 CycB2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 189, e.g., a P at position 189. 
     
     
         25 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 24 , which comprises a c M 552 CycB1 or c M 552 CycB2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 206, e.g., an insE at position 206. 
     
     
         26 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 25 , which comprises a c M 552 CycB1 or c M 552 CycB2 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 207, e.g., an insE at position 207. 
     
     
         27 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 26 , which comprises a c M 552 CycB1 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 195, e.g., an insD at position 195. 
     
     
         28 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 27 , which comprises a c M 552 CycB1 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 196, e.g., an insD at position 196. 
     
     
         29 . The preparation of  N. eutropha  bacterium of any of  claims 10 - 28 , which comprises a c M 552 CycB1 protein having (or gene encoding) a mutation relative to  N. eutropha  strain C91 at position 197, e.g., an insD at position 197. 
     
     
         30 . The preparation of  N. eutropha  bacterium of any of the preceding claims, which comprises at least one structural difference, e.g., at least one mutation, relative to a wild-type bacterium such as  N. eutropha  strain C91. 
     
     
         31 . The preparation of  N. eutropha  bacterium of any of the preceding claims, which comprises a nucleic acid that can be amplified using a pair of primers described herein, e.g., a primer comprising a sequence of SEQ ID NO: 64 and a primer comprising a sequence of SEQ ID NO: 65. 
     
     
         32 . The preparation of  N. eutropha  bacterium of any of the preceding claims, which comprises a nucleic acid or protein at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to a gene of  FIG. 6  or a protein encoded by a gene of  FIG. 6 . 
     
     
         33 . The preparation of  N. eutropha  bacterium of any of the preceding claims, which comprises a nucleic acid or protein at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to a sequence of any of SEQ ID NOS: 64-66 or a protein encoded by a sequence of any of SEQ ID NOS: 64-66. 
     
     
         34 . An  N. eutropha  bacterium, or a purified preparation thereof, comprising a mutation in an ammonia monooxygenase gene, a hydroxylamine oxidoreductase gene, a cytochrome c554 gene, or a cytochrome c m 552 gene relative to a wild-type bacterium such as  N. eutropha  strain C91. 
     
     
         35 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the amoA1 gene. 
     
     
         36 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the amoA2 gene. 
     
     
         37 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the amoB1 gene. 
     
     
         38 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the amoB2 gene. 
     
     
         39 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the amoC3 gene. 
     
     
         40 . The  N. eutropha  bacterium, or a purified preparation thereof, of any of  claims 34 - 39 , wherein said mutation is at a position described herein, e.g., in Table 2. 
     
     
         41 . The  N. eutropha  bacterium, or a purified preparation thereof, of any of  claims 34 - 39 , wherein said mutation is a mutation described herein, e.g., in Table 2. 
     
     
         42 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the hao1 gene. 
     
     
         43 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the hao2 gene. 
     
     
         44 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the hao3 gene. 
     
     
         45 . The  N. eutropha  bacterium, or a purified preparation thereof, of any of  claims 42 - 44 , wherein said mutation is at a position described herein, e.g., in Table 2. 
     
     
         46 . The  N. eutropha  bacterium, or a purified preparation thereof, of any of  claims 42 - 44 , wherein said mutation is a mutation described herein, e.g., in Table 2. 
     
     
         47 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the c554 cycA1 gene. 
     
     
         48 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the c554 cycA2 gene. 
     
     
         49 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the c554 cycA3 gene. 
     
     
         50 . The  N. eutropha  bacterium, or a purified preparation thereof, of any of  claims 47 - 49 , wherein said mutation is at a position described herein, e.g., in Table 2. 
     
     
         51 . The  N. eutropha  bacterium, or a purified preparation thereof, of any of  claims 47 - 49 , wherein said mutation is a mutation described herein, e.g., in Table 2. 
     
     
         52 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the c M 552 cycB1 gene. 
     
     
         53 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , wherein said mutation is in the c554 cycB2 gene. 
     
     
         54 . The  N. eutropha  bacterium, or a purified preparation thereof, of any of  claims 52 - 53 , wherein said mutation is at a position described herein, e.g., in Table 2. 
     
     
         55 . The  N. eutropha  bacterium, or a purified preparation thereof, of any of  claims 52 - 53 , wherein said mutation is a mutation described herein, e.g., in Table 2. 
     
     
         56 . The purified preparation of optimized  N. eutropha  bacterium of  claim 1 , comprising a mutation in an ammonia monooxygenase gene, a hydroxylamine oxidoreductase gene, a cytochrome c554 gene, or a cytochrome c m 552 gene. 
     
     
         57 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the amoA1 gene. 
     
     
         58 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the amoA2 gene. 
     
     
         59 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the amoB1 gene. 
     
     
         60 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the amoB2 gene. 
     
     
         61 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the amoC3 gene. 
     
     
         62 . The purified preparation of optimized  N. eutropha  bacterium of any of  claims 57 - 61 , wherein said mutation is at a position described herein, e.g., in Table 2. 
     
     
         63 . The purified preparation of optimized  N. eutropha  bacterium of any of  claims 57 - 61 , wherein said mutation is a mutation described herein, e.g., in Table 2. 
     
     
         64 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the hao1 gene. 
     
     
         65 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the hao2 gene. 
     
     
         66 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the hao3 gene. 
     
     
         67 . The purified preparation of optimized  N. eutropha  bacterium of any of  claims 64 - 66 , wherein said mutation is at a position described herein, e.g., in Table 2. 
     
     
         68 . The purified preparation of optimized  N. eutropha  bacterium of any of  claims 64 - 66 , wherein said mutation is a mutation described herein, e.g., in Table 2. 
     
     
         69 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the c554 cycA1 gene. 
     
     
         70 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the c554 cycA2 gene. 
     
     
         71 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the c554 cycA3 gene. 
     
     
         72 . The purified preparation of optimized  N. eutropha  bacterium of any of  claims 69 - 71 , wherein said mutation is at a position described herein, e.g., in Table 2. 
     
     
         73 . The purified preparation of optimized  N. eutropha  bacterium of any of  claims 69 - 71 , wherein said mutation is a mutation described herein, e.g., in Table 2. 
     
     
         74 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the c M 552 cycB1 gene. 
     
     
         75 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , wherein said mutation is in the c M 552 cycB2 gene. 
     
     
         76 . The purified preparation of optimized  N. eutropha  bacterium of any of  claims 56 ,  74 , and  75 , wherein said mutation is at a position described herein, e.g., in Table 2. 
     
     
         77 . The purified preparation of optimized  N. eutropha  bacterium of any of  claims 56 ,  74 , and  75 , wherein said mutation is a mutation described herein, e.g., in Table 2. 
     
     
         78 . The  N. eutropha  bacterium, or a purified preparation thereof, of  claim 34 , which has a mutation in at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions of one or more of amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, amoC3 gene, hao1 gene, hao2 gene, hao3 gene, c554 cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, c M 552 cycB1 gene, and c554 cycB2 gene. 
     
     
         79 . The purified preparation of optimized  N. eutropha  bacterium of  claim 56 , which has a mutation in at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions of one or more of amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, amoC3 gene, hao1 gene, hao2 gene, hao3 gene, c554 cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, c M 552 cycB1 gene, and c554 cycB2 gene. 
     
     
         80 . A  N. eutropha  bacterium comprising a chromosome that hybridizes at high stringency to SEQ ID NO: 1. 
     
     
         81 . The  N. eutropha  bacterium of  claim 80 , wherein the chromosome hybridizes at very high stringency to SEQ ID NO: 1. 
     
     
         82 . The  N. eutropha  bacterium of  claim 80  or  81 , which comprises at least one of the genes of  FIGS. 6-8 , or a gene with at least 80% identity thereto. 
     
     
         83 . The  N. eutropha  bacterium of  claim 80  or  81 , which comprises at least one of the genes of  FIGS. 6-8 . 
     
     
         84 . The  N. eutropha  bacterium of any of  claims 80 - 82 , which lacks any plasmid that is at least about 80% identical to SEQ ID NO: 2 or SEQ ID NO: 3. 
     
     
         85 . The  N. eutropha  bacterium of claim any of  claims 80 - 84 , which lacks any plasmid. 
     
     
         86 . A  N. eutropha  bacterium comprising one or more of an AmoA1 gene at least about 98.9% identical to SEQ ID NO: 7 and an amoA2 gene at least about 98.8% identical to SEQ ID NO: 13. 
     
     
         87 . A  N. eutropha  bacterium comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6 and an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12. 
     
     
         88 . A  N. eutropha  bacterium comprising one or more of an amoB1 gene at least about 99.2% identical to SEQ ID NO: 9 and an amoB2 gene at least about 99.2% identical to SEQ ID NO: 15. 
     
     
         89 . The  N. eutropha  bacterium of  claim 88 , further comprising one or more of an AmoA1 or amoA2 gene at least about 98.9% identical to SEQ ID NO: 7 or 13. 
     
     
         90 . An  N. eutropha  bacterium comprising one or more of an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8 or an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14. 
     
     
         91 . The  N. eutropha  bacterium of  claim 90 , further comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6 and an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12. 
     
     
         92 . An  N. eutropha  bacterium comprising one or more of an amoC1 gene at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene at least about 99.9% identical to SEQ ID NO: 11, and an amoC3 gene at least about 99.0% identical to SEQ ID NO: 17. 
     
     
         93 . The  N. eutropha  bacterium of  claim 92 , further comprising one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene at least about 99.2% identical to SEQ ID NO: 9, and an amoB2 gene at least about 99.2% identical to SEQ ID NO: 15. 
     
     
         94 . A  N. eutropha  bacterium comprising an AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16. 
     
     
         95 . The  N. eutropha  bacterium of  claim 94 , further comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, and an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14. 
     
     
         96 . A  N. eutropha  bacterium comprising one or more of a hao1 gene at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene at least about 99.5% identical to SEQ ID NO: 21, and a hao3 gene at least about 99.3% identical to SEQ ID NO: 23. 
     
     
         97 . The  N. eutropha  bacterium of  claim 96 , further comprising one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene at least about 99.9% identical to SEQ ID NO: 11, and an amoC3 gene at least about 99.0% identical to SEQ ID NO: 17. 
     
     
         98 . A  N. eutropha  bacterium comprising one or more of a Hao1 protein at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein at least about 99.7% identical to SEQ ID NO: 22. 
     
     
         99 . The  N. eutropha  bacterium of  claim 98 , further comprising an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, or an AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16. 
     
     
         100 . An  N. eutropha  bacterium comprising one or more of a cycA1 gene at least about 98.1% identical to SEQ ID NO: 25, a cycA2 gene at least about 98.8% identical to SEQ ID NO: 27, and a cycA3 gene at least about 99.4% identical to SEQ ID NO: 28. 
     
     
         101 . The  N. eutropha  bacterium of  claim 100 , further comprising one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene at least about 99.9% identical to SEEQ ID NO: 5, an amoC2 gene at least about 99.9% identical to SEQ ID NO: 11, an amoC3 gene at least about 99.0% identical to SEQ ID NO: 17, a hao1 gene at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene at least about 99.5% identical to SEQ ID NO: 21, and a hao3 gene at least about 99.3% identical to SEQ ID NO: 23. 
     
     
         102 . An  N. eutropha  bacterium comprising one or more of a CycA1 protein at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein at least about 99.7% identical to SEQ ID NO: 28. 
     
     
         103 . The  N. eutropha  bacterium of  claim 102 , further comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, an AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16, a Hao1 protein at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein at least about 99.7% identical to SEQ ID NO: 22. 
     
     
         104 . A  N. eutropha  bacterium comprising one or more of a cycB1 gene at least about 96.8% identical to SEQ ID NO: 31 and a cycB2 gene at least about 97.2% identical to SEQ ID NO: 33. 
     
     
         105 . The  N. eutropha  bacterium of  claim 104 , further comprising one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene at least about 99.9% identical to SEQ ID NO: 11, an amoC3 gene at least about 99.0% identical to SEQ ID NO: 17, a hao1 gene at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene at least about 99.5% identical to SEQ ID NO: 21, a hao3 gene at least about 99.3% identical to SEQ ID NO: 23, a cycA1 gene at least about 98.1% identical to SEQ ID NO: 25, a cycA2 gene at least about 98.8% identical to SEQ ID NO: 27, and a cycA3 gene at least about 99.4% identical to SEQ ID NO: 28. 
     
     
         106 . A  N. eutropha  bacterium comprising one or more of a CycB1 protein at least about 97.2% identical to SEQ ID NO: 30 or a CycB2 protein at least about 98.8% identical to SEQ ID NO: 32. 
     
     
         107 . The  N. eutropha  bacterium of  claim 106 , further comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, an AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16, a Hao1 protein at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein at least about 99.7% identical to SEQ ID NO: 20, a Hao3 protein at least about 99.7% identical to SEQ ID NO: 22, a CycA1 protein at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein at least about 99.7% identical to SEQ ID NO: 28. 
     
     
         108 . A  N. eutropha  bacterium comprising one or more genes according to SEQ ID NOS: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33. 
     
     
         109 . A  N. eutropha  bacterium comprising one or more proteins according to SEQ ID NOS: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32. 
     
     
         110 . A  N. eutropha  bacterium comprising a protein that is mutant relative to  N. eutropha  strain C91 at at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the amino acid positions listed in Table 2. 
     
     
         111 . A  N. eutropha  bacterium comprising proteins that are mutant relative to  N. eutropha  strain C91 at all of the amino acid positions listed in Table 2. 
     
     
         112 . The  N. eutropha  bacterium of any one of  claims 1 - 111 , which is transgenic. 
     
     
         113 . The  N. eutropha  bacterium of any one of  claims 80 - 112 , having at least one property selected from an optimized growth rate, an optimized NH 4   +  oxidation rate, and an optimized resistance to NH 4   + . 
     
     
         114 . The  N. eutropha  bacterium of  claim 113 , which has at least two properties selected from an optimized growth rate, an optimized NH 4   +  oxidation rate, and an optimized resistance to NH 4   + . 
     
     
         115 . The  N. eutropha  bacterium of  claim 113 , which has an optimized growth rate, an optimized NH 4   +  oxidation rate, and an optimized resistance to NH 4   + . 
     
     
         116 . A composition comprising the  N. eutropha  bacterium of any one of  claims 1 - 115 , wherein the composition is substantially free of other organisms. 
     
     
         117 . A composition comprising the  N. eutropha  bacterium of one any of  claims 1 - 115  and further comprising a second organism, wherein the composition is substantially free of other organisms. 
     
     
         118 . The composition of  claim 117 , wherein the second organism is an ammonia oxidizing bacterium. 
     
     
         119 . The composition of  claim 117 , wherein the second organism is selected from the group consisting of  Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus , and  Bifidobacter , and combinations thereof. 
     
     
         120 . A composition comprising a cell suspension of an actively dividing culture of  N. eutropha  bacteria having an OD600 of at least about 0.2, wherein the composition is substantially free of other organisms. 
     
     
         121 . A composition for topical administration, comprising the  N. eutropha  bacterium of any one of  claims 1 - 115  and a pharmaceutically or cosmetically acceptable excipient suitable for topical administration. 
     
     
         122 . The composition of  claim 121 , which is substantially free of other organisms. 
     
     
         123 . The composition of  claim 121 , further comprising a second organism. 
     
     
         124 . The composition of  claim 123 , wherein the second organism is an ammonia oxidizing bacterium. 
     
     
         125 . The composition of  claim 123 , wherein the second organism is selected from the group consisting of  Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus , and  Bifidobacter , and combinations thereof. 
     
     
         126 . The composition of any of  claims 121 - 125 , which is provided as or disposed in a powder, cosmetic, cream, stick, aerosol, salve, wipe, or bandage. 
     
     
         127 . The composition of any of  claims 121 - 126 , which further comprises a moisturizing agent, deodorizing agent, scent, colorant, insect repellant, cleansing agent, or UV-blocking agent. 
     
     
         128 . The composition of any of  claims 121 - 127 , wherein the excipient comprises an anti-adherent, binder, coat, disintegrant, filler, flavor, color, lubricant, glidant, sorbent, preservative, or sweetener. 
     
     
         129 . The composition of any of  claims 121 - 128 , wherein the concentration of  N. eutropha  in the composition is about 10 11 -10 12  CFU/L. 
     
     
         130 . The composition of any of  claims 121 - 129 , wherein the concentration of  N. eutropha  in the composition is about 10 9  CFU/ml. 
     
     
         131 . The composition of any of  claims 121 - 130 , wherein the mass ratio of  N. eutropha  to pharmaceutical excipient is in a range of about 0.1 grams per liter to about 1 gram per liter. 
     
     
         132 . A composition comprising at least about 1,000 L at about 10 12  CFUs/L of the  N. eutropha  bacterium of any one of  claims 1 - 115 . 
     
     
         133 . A composition comprising at least about 1, 2, 5, 10, 20, 50, 100, 200, or 500 g of the  N. eutropha  bacterium of any one of  claims 1 - 115 , e.g., as a dry formulation such as a powder. 
     
     
         134 . An article of clothing comprising the  N. eutropha  of any one of  claims 1 - 115 , e.g., at a concentration that provides one or more of a treatment or prevention of a skin disorder, a treatment or prevention of a disease or condition associated with low nitrite levels, a treatment or prevention of body odor, a treatment to supply nitric oxide to a subject, or a treatment to inhibit microbial growth. 
     
     
         135 . The article of clothing of  claim 134 , which is packaged. 
     
     
         136 . The article of clothing of  claim 134 - 135 , which is packaged in a material that is resistant to gaseous exchange or resistant to water. 
     
     
         137 . A cloth comprising the  N. eutropha  of any one of  claims 1 - 115 . 
     
     
         138 . A yarn comprising the  N. eutropha  of any one of  claims 1 - 115 . 
     
     
         139 . A thread comprising the  N. eutropha  of any one of  claims 1 - 115 . 
     
     
         140 . A method of obtaining, e.g., manufacturing, an  N. eutropha  bacterium having an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + , comprising:
 (a) culturing the bacterium under conditions that select for one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + , thereby producing a culture; 
 (b) testing a sample from the culture for an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + ; and 
 (c) repeating the culturing and testing steps until a bacterium having an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   +  is obtained. 
 
     
     
         141 . The method of  claim 140 , further comprising a step of obtaining an  N. eutropha  bacterium from a source. 
     
     
         142 . The method of  claim 141 , wherein the source is soil or the skin of an individual. 
     
     
         143 . The method of  claim 142 , wherein culturing the bacterium under conditions that select for one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   +  comprises culturing the bacterium in  N. europae  medium that comprises about 200 mM NH 4   + . 
     
     
         144 . The method of  claim 143 , which comprises a step of creating an axenic culture. 
     
     
         145 . The method of  claim 143  or  144 , which comprises a step of co-culturing the  N. eutropha  together with at least one other type of ammonia oxidizing bacteria. 
     
     
         146 . The method of any of  claims 140 - 145 , wherein the  N. eutropha  of step (a) lack an optimized growth rate, an optimized NH 4   +  oxidation rate, and an optimized resistance to NH 4   + . 
     
     
         147 . The method of any of  claims 140 - 146 , wherein step (c) comprises repeating the culturing and testing steps until a bacterium having at least two of an optimized growth rate, an optimized NH 4   +  oxidation rate, and an optimized resistance to NH 4   +  is obtained. 
     
     
         148 . An  N. eutropha  bacterium produced by the method of any of  claims 140 - 147 . 
     
     
         149 . A method of testing a preparation of  N. eutropha , comprising:
 assaying the  N. eutropha  for one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + ; and   if the  N. eutropha  has one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + , classifying the  N. eutropha  as accepted.   
     
     
         150 . The method of  claim 149 , further comprising a step of testing the preparation for contaminating organisms. 
     
     
         151 . The method of any of  claims 149 - 150 , further comprising a step of removing a sample from the preparation and conducting testing on the sample. 
     
     
         152 . The method of any of  claims 149 - 151 , further comprising testing medium in which the  N. eutropha  is cultured. 
     
     
         153 . The method of any of  claims 149 - 152 , further comprising packaging  N. eutropha  from the preparation into a package. 
     
     
         154 . The method of any of  claims 149 - 153 , further comprising placing  N. eutropha  from the preparation into commerce. 
     
     
         155 . A method of producing, e.g., manufacturing  N. eutropha , comprising contacting  N. eutropha  with culture medium and culturing the  N. eutropha  until an OD600 of at least about 0.5 is reached. 
     
     
         156 . The method of  claim 155 , further comprising assaying the  N. eutropha  and culture medium for contaminating organisms. 
     
     
         157 . The method of any of  claims 155 - 156 , further comprising assaying the  N. eutropha  for one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + . 
     
     
         158 . The method of any of  claims 155 - 157 , which comprises producing at least at least about 1,000 L per day at about 10 12  CFUs/L of  N. eutropha.    
     
     
         159 . A method of producing, e.g., manufacturing,  N. eutropha , comprising contacting  N. eutropha  with culture medium and culturing the  N. eutropha  until about at least about 1,000 L at about 10 12  CFUs/L  N. eutropha  are produced. 
     
     
         160 . The method of  claim 159 , further comprising a step of assaying the  N. eutropha  for one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + . 
     
     
         161 . The method of any of  claims 159 - 160 , further comprising a step of testing the  N. eutropha  or culture medium for contaminating organisms. 
     
     
         162 . The method of any of  claims 159 - 161 , wherein the  N. eutropha  brought into contact with the culture medium is an  N. eutropha  having one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + . 
     
     
         163 . A method of producing, e.g., manufacturing  N. eutropha , comprising:
 (a) contacting  N. eutropha  with a culture medium; and   (b) culturing the  N. eutropha  for 1-2 days, thereby creating a culture, until the culture reaches an OD600 of about 0.5-0.6.   
     
     
         164 . The method of  claim 163 , further comprising a step of assaying the  N. eutropha  for one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + . 
     
     
         165 . The method of any of  claims 163 - 164 , further comprising a step of testing the culture for contaminating organisms. 
     
     
         166 . The method of any of  claims 163 - 165 , wherein the  N. eutropha  of step (a) is an  N. eutropha  having one or more of an optimized growth rate, an optimized NH 4   +  oxidation rate, or an optimized resistance to NH 4   + . 
     
     
         167 . The method of any of  claims 163 - 166 , which comprises producing at least at least about 1,000 L per day at about 10 12  CFUs/L of  N. eutropha.    
     
     
         168 . An  N. eutropha  bacterium produced by the method of any of  claims 155 - 167 . 
     
     
         169 . A preparation of  N. eutropha  made by the method of any of  claims 155 - 167 . 
     
     
         170 . The preparation of  claim 169 , wherein the preparation comprises at least about 0.1 to about 100 milligrams (mg) of  N. eutropha.    
     
     
         171 . A reaction mixture comprising  N. eutropha  at an optical density of about 0.5 to about 0.6. 
     
     
         172 . A method of producing  N. eutropha -bearing clothing, comprising contacting an article of clothing with of the  N. eutropha  of any one of  claims 1 - 115 . 
     
     
         173 . The method of  claim 172 , which comprises producing at least 10, 100, or 1000 articles of clothing. 
     
     
         174 . The method of  claim 172 , which comprises contacting the article of clothing with at least 10 10  CFUs of  N. eutropha.    
     
     
         175 . The method of  claim 172 , further comprising packaging the clothing. 
     
     
         176 . A method of obtaining a formulation of  N. eutropha , combining contacting  N. eutropha  of any of  claims 1 - 115  with a pharmaceutically or cosmetically acceptable excipient. 
     
     
         177 . The method of  claim 176 , further comprising mixing the  N. eutropha  and the excipient. 
     
     
         178 . The method of  claim 176 , which is performed under conditions that are substantially free of contaminating organisms. 
     
     
         179 . A method of packaging  N. eutropha , comprising assembling  N. eutropha  of any of  claim 1 - 115  into a package. 
     
     
         180 . The method of  claim 179 , wherein the package is resistant to gaseous exchange or resistant to water. 
     
     
         181 . The method of  claim 179 , wherein the package is permeable to gaseous exchange, NH 3 , NH 4   + , or NO 2   − . 
     
     
         182 . A method of inhibiting microbial growth on a subject's skin, comprising topically administering to a subject in need thereof an effective dose of the  N. eutropha  bacteria of any one of  claims 1 - 115 . 
     
     
         183 . The method of  claim 182 , wherein the effective dose is approximately 1.5×10 10  CFU. 
     
     
         184 . The method of any of  claims 182 - 183 , wherein the administration is performed twice per day. 
     
     
         185 . The method of any of  claims 182 - 184 , wherein the subject is a human. 
     
     
         186 . The method of any of  claims 182 - 185 , wherein the microbial growth to be inhibited is growth of  Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes , or  Acinetobacter baumannii.    
     
     
         187 . A method of supplying nitric oxide to a subject, comprising positioning an effective dose of the  N. eutropha  bacteria of any one of  claims 1 - 115  in close proximity to the subject. 
     
     
         188 . A method of reducing body odor, comprising topically administering to a subject in need thereof an effective dose of the  N. eutropha  bacteria of any one of  claims 1 - 115 . 
     
     
         189 . A method of treating a disease associated with low nitrite levels, comprising topically administering to a subject in need thereof a therapeutically effective dose of the  N. eutropha  bacteria of any of  claims 1 - 115 . 
     
     
         190 . The method of  claim 189 , wherein the disease is HIV dermatitis, infection in a diabetic foot ulcer, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reaction, psoriasis, skin infections, vascular disease, vaginal yeast infection, a sexually transmitted disease, heart disease, atherosclerosis, baldness, leg ulcers secondary to diabetes or confinement to bed, angina, particularly chronic, stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end stage renal disease, obesity, impotence, or cancer. 
     
     
         191 . A method of treating a skin disorder, comprising topically administering to a subject in need thereof a therapeutically effective dose of the  N. eutropha  bacteria of any of  claims 1 - 115 . 
     
     
         192 . The method of  claim 191 , wherein the skin disorder is acne, e.g., acne vulgaris, rosacea, eczema, or psoriasis. 
     
     
         193 . The method of  claim 191 , wherein the skin disorder is an ulcer, e.g., venous ulcer, e.g., leg ulcer, e.g., venous leg ulcer, e.g., infection in a diabetic foot ulcer. 
     
     
         194 . The method of any one of  claims 191 - 193 , wherein topically administering comprises pre-treating the subject with  N. eutropha , e.g., an  N. eutropha  of any of  claims 1 - 115 . 
     
     
         195 . The method of any one of  claims 191 - 194 , wherein topically administering comprises topically administering prior to occurrence of the skin disorder. 
     
     
         196 . The method of any one of  claims 191 - 195 , wherein topically administering comprises topically administering subsequent to occurrence of the skin disorder. 
     
     
         197 . A method of promoting wound healing or closure, comprising administering to a wound an effective dose of the  N. eutropha  bacteria of any of  claims 1 - 115 . 
     
     
         198 . The method of  claim 197 , wherein the wound comprises one or more undesirable bacteria, e.g., pathogenic bacteria. 
     
     
         199 . The method of  claim 197 , wherein the wound comprises  Staphylococcus aureus, Pseudomonas aeruginosa , or  Acinetobacter baumannii.    
     
     
         200 . The method of  claim 197 , wherein the  N. eutropha  is administered to the subject prior to occurrence of the wound. 
     
     
         201 . The method of  claim 197 , wherein administering to the wound comprises administering to the subject prior to occurrence of the wound. 
     
     
         202 . The method of any one of  claims 197 - 201 , further comprising administering  N. eutropha  to the wound subsequent to occurrence of the wound. 
     
     
         203 . A method of killing or inhibiting growth of pathogenic bacteria comprising contacting, e.g., applying,  N. eutropha  bacteria, e.g., an  N. eutropha  bacterium of any of  claims 1 - 115 , to the skin. 
     
     
         204 . The method of  claim 203 , wherein the pathogenic bacteria contribute to one or more of the following conditions: HIV dermatitis, an ulcer, e.g., venous ulcer, e.g., leg ulcer, e.g., venous leg ulcer, e.g., infection in a diabetic foot ulcer, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reaction, psoriasis, uticaria, rosacea, skin infections, vascular disease, vaginal yeast infection, a sexually transmitted disease, heart disease, atherosclerosis, baldness, leg ulcers secondary to diabetes or confinement to bed, angina, particularly chronic, stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermal lysis bulosa, or cancer. 
     
     
         205 . The method of  claim 204 , wherein the condition is an ulcer, e.g., venous ulcer, e.g., leg ulcer, e.g., venous leg ulcer, e.g., infection in a diabetic foot ulcer. 
     
     
         206 . The method of  claim 204 , wherein the condition is a venous leg ulcer. 
     
     
         207 . The method of  claim 204 , wherein the condition is acne, e.g., acne vulgaris. 
     
     
         208 . The method of  claim 204 , wherein the condition is acne vulgaris. 
     
     
         209 . The method of any one of  claims 203 - 208 , wherein the pathogenic bacteria is one or more of  Propionibacterium acnes, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes , or  Acinetobacter baumannii.    
     
     
         210 . The method of any one of  claims 203 - 209 , further comprising determining whether the subject is in need of killing or inhibiting growth of pathogenic bacteria, e.g., determining that the subject is in need of killing or inhibiting growth of pathogenic bacteria. 
     
     
         211 . The method of any one of  claims 203 - 210 , further comprising selecting the subject in need of killing or inhibiting growth of pathogenic bacteria. 
     
     
         212 . A method of changing a composition of a skin microbiome of a subject comprising:
 administering, e.g., applying, a preparation comprising ammonia oxidizing bacteria to a surface of the skin,   wherein the amount and frequency of administration, e.g., application, is sufficient to reduce the proportion of pathogenic bacteria on the surface of the skin.   
     
     
         213 . The method of  claim 212 , further comprising, selecting the subject on the basis of the subject being in need of a reduction in the proportion of pathogenic bacteria on the surface of the skin. 
     
     
         214 . The method of any one of  claims 212 - 213 , wherein the preparation comprises at least one of ammonia, ammonium salts, and urea. 
     
     
         215 . The method of any one of  claims 212 - 214 , wherein the preparation comprises a controlled release material, e.g., slow release material. 
     
     
         216 . The method of any one of  claims 212 - 215 , wherein the preparation of ammonia oxidizing bacteria, further comprises an excipient, e.g., one of a pharmaceutically acceptable excipient or a cosmetically acceptable excipient. 
     
     
         217 . The method of  claim 216 , wherein the excipient, e.g., one of the pharmaceutically acceptable excipient and the cosmetically acceptable excipient, is suitable for one of topical, nasal, pulmonary, and gastrointestinal administration. 
     
     
         218 . The method of any one of  claims 216 - 217 , wherein the excipient, e.g., one of the pharmaceutically acceptable excipient and the cosmetically acceptable excipient, is a surfactant. 
     
     
         219 . The method of  claim 218 , wherein the surfactant is selected from the group consisting of cocamidopropyl betaine (ColaTeric COAB), polyethylene sorbitol ester (e.g., Tween 80), ethoxylated lauryl alcohol (RhodaSurf 6 NAT), sodium laureth sulfate/lauryl glucoside/cocamidopropyl betaine (Plantapon 611 L UP), sodium laureth sulfate (e.g., RhodaPex ESB 70 NAT), alkyl polyglucoside (e.g., Plantaren 2000 N UP), sodium laureth sulfate (Plantaren 200), Dr. Bronner's Castile soap, Lauramine oxide (ColaLux Lo), sodium dodecyl sulfate (SDS), polysulfonate alkyl polyglucoside (PolySufanate 160 P), sodium lauryl sulfate (Stepanol-WA Extra K), and any combination thereof. 
     
     
         220 . The method of any one of  claims 212 - 219 , wherein the preparation is substantially free of other organisms. 
     
     
         221 . The method of any one of  claims 212 - 220 , wherein the preparation is disposed in a powder, cosmetic, cream, stick, aerosol, salve, wipe, or bandage. 
     
     
         222 . The method of any one of  claims 212 - 221 , wherein the preparation is provided as a powder, cosmetic, cream, stick, aerosol, salve, wipe, or bandage. 
     
     
         223 . The method of any one of  claims 212 - 222 , wherein the preparation comprises a moisturizing agent, deodorizing agent, scent, colorant, insect repellant, cleansing agent, or UV-blocking agent. 
     
     
         224 . The method of any one of  claims 216 - 217 , wherein the excipient, e.g., the pharmaceutically acceptable excipient or the cosmetically acceptable excipient, comprises an anti-adherent, binder, coat, disintegrant, filler, flavor, color, lubricant, glidant, sorbent, preservative, or sweetener. 
     
     
         225 . The method of any one of  claims 212 - 224 , wherein the preparation comprising ammonia oxidizing bacteria comprises about 10 8  to about 10 14  CFU/L. 
     
     
         226 . The method of  claim 225 , wherein the preparation comprises between about 1×10 9  CFU/L to about 10×10 9  CFU/L. 
     
     
         227 . The method of any one of  claims 212 - 226 , wherein the preparation comprising ammonia oxidizing bacteria comprises between about 50 milligrams (mg) and about 1000 mg of ammonia oxidizing bacteria. 
     
     
         228 . The method of any one of  claims 216 - 227 , wherein the mass ratio of ammonia oxidizing bacteria to the excipient, e.g., the pharmaceutically acceptable excipient or the cosmetically acceptable excipient is in a range of about 0.1 grams per liter to about 1 gram per liter. 
     
     
         229 . The method of any one of  claims 212 - 228 , wherein the preparation of ammonia oxidizing bacteria are useful for treating or preventing a skin disorder, a treatment or prevention of a disease or condition associated with low nitrite levels, a treatment or prevention of body odor, a treatment to supply nitric oxide to a subject, or a treatment to inhibit microbial growth, e.g., pathogenic bacterial growth. 
     
     
         230 . The method of any one of  claims 212 - 229 , wherein the ammonia oxidizing bacteria is selected from the group consisting of  Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio , and combinations thereof. 
     
     
         231 . The method of any one of  claims 212 - 230 , wherein the preparation comprises an organism selected from the group consisting of  Lactobacillus, Streptococcus, Bifidobacter , and combinations thereof. 
     
     
         232 . The method of any one of  claims 212 - 230 , wherein the preparation is substantially free of organisms other than ammonia oxidizing bacteria. 
     
     
         233 . The method of any one of  claims 212 - 232 , wherein the preparation of ammonia oxidizing bacteria comprises ammonia oxidizing bacteria in a growth state. 
     
     
         234 . The method of any one of  claims 212 - 232 , wherein the preparation of ammonia oxidizing bacteria comprises ammonia oxidizing bacteria in a storage state. 
     
     
         235 . The method of any one of  claims 212 - 234 , to deliver a cosmetic product. 
     
     
         236 . The method of any one of  claims 212 - 234 , to deliver a therapeutic product. 
     
     
         237 . The method of any one of  claims 212 - 236 , wherein the preparation is useful for treatment of at least one of HIV dermatitis, infection in a diabetic foot ulcer, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reaction, psoriasis, uticaria, rosacea, skin infections, vascular disease, vaginal yeast infection, a sexually transmitted disease, heart disease, atherosclerosis, baldness, leg ulcers secondary to diabetes or confinement to bed, angina, particularly chronic, stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermal lysis bulosa, or cancer. 
     
     
         238 . The method of  claim 237 , wherein the preparation is useful for treatment of at least one of acne, e.g., acne vulgaris, eczema, psoriasis, uticaria, rosacea, and skin infections. 
     
     
         239 . The method of any one of  claims 212 - 238 , wherein the preparation is provided in a container, the preparation and the container having a weight of less than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 grams. 
     
     
         240 . The method of any one of  claims 212 - 239 , wherein the preparation has less than about 0.1% to about 10% of surfactant. 
     
     
         241 . The method of any one of  claims 212 - 240 , wherein the preparation is substantially free of surfactant. 
     
     
         242 . The method of any one of  claims 212 - 241 , wherein the preparation comprises a chelator. 
     
     
         243 . The method of any one of  claims 212 - 242 , wherein the preparation is applied about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times per day. 
     
     
         244 . The method of any one of  claims 212 - 243 , wherein the preparation is applied one time per day. 
     
     
         245 . The method of any one of  claims 212 - 243 , wherein the preparation is applied two times per day. 
     
     
         246 . The method of any one of  claims 212 - 245 , wherein the preparation is applied for about 1-3, 3-5, 5-7, 7-9, 5-10, 10-14, 12-18, 12-21, 21-28, 28-35, 35-42, 42-49, 49-56, 46-63, 63-70, 70-77, 77-84, or 84-91 days. 
     
     
         247 . The method of any one of  claims 212 - 246 , wherein the preparation is applied for about 16 days. 
     
     
         248 . The method of any one of  claims 212 - 247  further comprising obtaining a sample from the surface of the skin. 
     
     
         249 . The method of  claim 248 , further comprising isolating DNA of bacteria in the sample. 
     
     
         250 . The method of any one of  claims 248 - 249 , further comprising sequencing DNA of bacteria in the sample. 
     
     
         251 . The method of any one of  claims 212 - 250 , wherein administering the ammonia oxidizing bacteria provides for an increase in the proportion of non-pathogenic bacteria on the surface. 
     
     
         252 . The method of  claim 251 , wherein the non-pathogenic bacteria is commensal non-pathogenic bacteria. 
     
     
         253 . The method of  claim 252 , wherein the non-pathogenic bacteria is commensal non-pathogenic bacteria of the genus  Staphylococcus.    
     
     
         254 . The method of  claim 253 , wherein the non-pathogenic bacteria is commensal non-pathogenic bacteria  Staphylococcus epidermidis.    
     
     
         255 . The method of any one of  claims 252 - 254 , wherein the non-pathogenic bacteria of the genus  Staphylococcus  is, or is identified as being, increased after about 2 weeks. 
     
     
         256 . The method of  claim 255 , wherein the non-pathogenic bacteria  Staphylococcus epidermidis  is, or is identified as being, increased after about 2 weeks. 
     
     
         257 . The method of any one of  claims 212 - 256 , wherein potentially pathogenic or disease associated Propionibacteria is, or is identified as being, reduced after about 2 weeks. 
     
     
         258 . The method of any one of  claims 212 - 257 , wherein potentially pathogenic or disease associated  Stenotrophomonas  is, or is identified as being, reduced after about 2 weeks. 
     
     
         259 . The method of any one of  claims 212 - 258 , wherein the surface of the skin comprises a wound. 
     
     
         260 . A method of treating acne e.g., acne vulgaris, by the method of any one of  claims 212 - 259 . 
     
     
         261 . A method of treating eczema by the method of any one of  claims 212 - 259 . 
     
     
         262 . A method of treating psoriasis by the method of any one of  claims 212 - 259 . 
     
     
         263 . A method of treating uticaria by the method of any one of  claims 212 - 259 . 
     
     
         264 . A method of treating rosacea by the method of any one of  claims 212 - 259 . 
     
     
         265 . A method of treating a skin infection by the method of any one of  claims 212 - 259 . 
     
     
         266 . A method of reducing an amount of undesirable bacteria on a surface of a subject by the method of any one of  claims 212 - 258 . 
     
     
         267 . A nucleic acid comprising a sequence of 15-100 consecutive nucleotides from within SEQ ID NO: 66, or a reverse complement thereof, provided that the nucleic acid has a non-naturally occurring sequence, or another modification, e.g., a label, or both. 
     
     
         268 . The nucleic acid of  claim 267 , wherein the sequence of 15-100 consecutive nucleotides is a sequence not found in  N. Eutropha  strain C91. 
     
     
         269 . The nucleic acid of  claim 267  or  268 , further comprising a heterologous sequence 5′ to the sequence of 15-100 consecutive nucleotides from within SEQ ID NO: 66. 
     
     
         270 . The nucleic acid of  claim 267  or  268 , further comprising a heterologous sequence 3′ to the sequence of 15-100 consecutive nucleotides from within SEQ ID NO: 66. 
     
     
         271 . The nucleic acid of  claim 267  or  268 , further comprising a first heterologous sequence 5′ to the sequence of 15-100 consecutive nucleotides from within SEQ ID NO: 66 and a second heterologous sequence 3′ to the sequence of 15-100 consecutive nucleotides from within SEQ ID NO: 66. 
     
     
         272 . The nucleic acid of any of  claims 267 - 271 , which has a length of 15-20, 20-25, 25-30, 30-24, or 25-40 nucleotides. 
     
     
         273 . The nucleic acid of any of  claims 267 - 272 , which is bound, e.g., covalently bound, to a detectable label, e.g., a fluorescent label. 
     
     
         274 . A composition comprising:
 a first nucleic acid comprising 15-100 consecutive nucleotides from within SEQ ID NO: 66; and   a second nucleic acid comprising 15-100 consecutive nucleotides from within a reverse complement of SEQ ID NO: 66,   provided that the first nucleic acid or the second nucleic acid or both has a non-naturally occurring sequence or a modification such as a label, or both.   
     
     
         275 . The composition of  claim 274 , wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and second nucleic acid does not comprise a sequence found in N.  Eutropha  strain C91. 
     
     
         276 . The composition of  claim 274  or  275 , wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and second nucleic acid further comprises a heterologous sequence 5′ to the sequence of 15-100 consecutive nucleotides from within SEQ ID NO: 66. 
     
     
         277 . The composition of any of  claims 274 - 276 , wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and second nucleic acid further comprises a heterologous sequence 3′ to the sequence of 15-100 consecutive nucleotides from within SEQ ID NO: 66. 
     
     
         278 . The composition of any of  claims 274 - 277 , wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and second nucleic acid has a length of 15-20, 20-25, 25-30, 30-24, or 25-40 nucleotides. 
     
     
         279 . The composition of any of  claims 274 - 278 , wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and second nucleic acid is bound, e.g., covalently bound, to a detectable label, e.g., a fluorescent label. 
     
     
         280 . A nucleic acid consisting of the sequence AATCTGTCTCCACAGGCAGC (SEQ ID NO: 64). 
     
     
         281 . A nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65). 
     
     
         282 . A molecule comprising the nucleic acid of  claim 280  or  281  and a detectable label, e.g., a fluorescent label. 
     
     
         283 . A composition comprising a first nucleic acid consisting of the sequence AATCTGTCTCCACAGGCAGC (SEQ ID NO: 64) and a second nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65). 
     
     
         284 . A composition comprising:
 a first molecule comprising (i) a first nucleic acid consisting of the sequence AATCTGTCTCCACAGGCAGC (SEQ ID NO: 64) and optionally comprising (ii) a detectable label, e.g., a fluorescent label; and   a second molecule comprising (i) a second nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65) and optionally comprising (ii) a detectable label, e.g., a fluorescent label.   
     
     
         285 . A method of detecting whether a D23  N. eutropha  nucleic acid is present in a sample, comprising:
 performing a polymerase chain reaction (PCR) on the sample using primers specific to  N. eutropha  D23, and   determining whether a PCR product is produced, wherein the presence of a PCR product indicates that the D23  N. eutropha  nucleic acid was present in the sample.