US2016244758A1PendingUtilityA1

Targeting glioma stem cells by sequence-specific functional inhibition of pro-survival oncomir-138

37
Assignee: AGENCY SCIENCE TECH & RESPriority: Dec 20, 2010Filed: Feb 11, 2016Published: Aug 25, 2016
Est. expiryDec 20, 2030(~4.4 yrs left)· nominal 20-yr term from priority
Inventors:Prabha Sampath
A61P 35/00C12N 2740/16043C12Q 2600/118C12N 15/113C12Q 2600/158C12N 2310/141C12Q 1/6886C12Q 2600/178A61K 31/7088C12N 2310/531C12N 2310/315C12N 2320/30C12N 2310/113
37
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Methods for malignant glioma diagnosis/prognosis using miR-138 as a prognostic biomarker and methods for treating malignant glioma and inhibiting glioma stem cell growth by suppressing miR-138. Also disclosed herein are pharmaceutical compositions for use in treating malignant glioma, prolonging survival of malignant glioma patients, or eliminating GSCs and in turn tumor growth, the pharmaceutical composition comprising an oligonucleotide that targets miR- 138.

Claims

exact text as granted — not AI-modified
1 - 6 . (canceled) 
     
     
         7 . A method for treating malignant glioma, comprising administering to a subject in need thereof an effective amount of an oligonucleotide targeting miR-138. 
     
     
         8 . The method of  claim 7 , wherein the amount of the oligonucleotide is effective in suppressing glioma stem cell proliferation. 
     
     
         9 . The method of  claim 7 , wherein the amount of the oligonucleotide is effective in inducing apoptosis in glioma stem cells. 
     
     
         10 . The method of  claim 7 , wherein the subject is a human subject suffering from, suspected of having, or at risk for malignant glioma. 
     
     
         11 . The method of  claim 7 , wherein the oligonucleotide is a hairpin oligonucleotide. 
     
     
         12 . The method of  claim 7 , wherein one or more of the nucleotides in the oligonucleotide are modified by a 2′-O-methoxy group, a 2′-O-methoxyethyl group, or a phosphorothioate group. 
     
     
         13 . The method of  claim 7 , wherein the oligonucleotide comprises the nucleotide sequence of 5′-CGGCCTGATTCACAACACCAGCT-3′ (SEQ ID NO:1). 
     
     
         14 . The method of  claim 13 , wherein the oligonucleotide comprises the nucleotide sequence of 5′GAGCTGGTATTGTGAATCAAGCAGCTTCCTGTCAGCGGCCTGATTCA CAACACCAGCTTTTTT3′ (SEQ ID NO:2). 
     
     
         15 . A method for inhibiting glioma stem cell growth, comprising contacting glioma stem cells with an effective amount of an oligonucleotide targeting miR-138. 
     
     
         16 . The method of  claim 15 , wherein the contacting step is performed by administering the oligonucleotide to a subject in need thereof. 
     
     
         17 . The method of  claim 16 , wherein the subject is a human subject suffering from, suspected of having, or at risk for malignant glioma. 
     
     
         18 . The method of  claim 15 , wherein the amount of the oligonucleotide is effective in suppressing proliferation of the glioma stem cells. 
     
     
         19 . The method of  claim 15 , wherein the amount of the oligonucleotide is effective in inducing apoptosis in the glioma stem cells. 
     
     
         20 . The method of  claim 15 , wherein the oligonucleotide is a hairpin oligonucleotide. 
     
     
         21 . The method of  claim 15 , wherein one or more of the nucleotides in the oligonucleotide are modified by a 2′-O-methoxy group, a 2′-O-methoxyethyl group, or a phosphorothioate group. 
     
     
         22 . The method of  claim 15  any of  claims 15   18 , wherein the oligonucleotide comprises the nucleotide sequence of 5′-CGGCCTGATTCACAACACCAGCT-3′ (SEQ ID NO:1). 
     
     
         23 . The method of  claim 22 , wherein the oligonucleotide comprises the nucleotide sequence of 5′GAGCTGGTATTGTGAATCAAGCAGCTTCCTGTCAGCGGCCTGATTCA CAACACCAGCTTTTTT3′ (SEQ ID NO:2). 
     
     
         24 . A method for prolonging survival of a subject suffering from malignant glioma, the method comprising administering to the subject an effective amount of an oligonucleotide targeting miR-138. 
     
     
         25 - 26 . (canceled) 
     
     
         27 . The method of  claim 24 , wherein the subject is a human patient having malignant glioma and wherein the human patient has undergone or is in the course of one or more additional malignant glioma treatments. 
     
     
         28 . The method of  claim 27 , wherein the one or more additional malignant glioma treatments are surgery, radiotherapy, and/or chemotherapy. 
     
     
         29 - 49 . (canceled)

Join the waitlist — get patent alerts

Track US2016244758A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.