US2016168577A1PendingUtilityA1

Clusterin Antisense Therapy for Treatment of Cancer

Assignee: UNIV BRITISH COLUMBIAPriority: Apr 2, 2004Filed: Nov 4, 2015Published: Jun 16, 2016
Est. expiryApr 2, 2024(expired)· nominal 20-yr term from priority
C12N 2310/346A61K 31/7105A61K 31/711C12N 2310/321C12N 2310/341C12N 15/113A61K 31/337C12N 2310/3341C12N 15/111A61K 31/7088A61N 5/10C12N 2320/31C12N 15/1137C12N 2310/11A61K 31/7068A61P 35/00A61K 31/7052C12N 2310/315A61K 33/24A61K 33/243
52
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and/or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament.

Claims

exact text as granted — not AI-modified
1 . A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising the step of administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin. 
     
     
         2 . The method of  claim 1 , wherein the amount of anti-clusterin antisense oligonucleotide administered is from 300 to 640 mg. 
     
     
         3 . The method of  claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). 
     
     
         4 . The method of  claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence ATTGTCTGAGACCGTCTGGTC (Seq. ID No. 2). 
     
     
         5 . The method of  claim 1 , wherein the anti-clusterin antisense oligonucleotide has the sequence GCTGGGCGGAGTTGGGGGCCT (Seq. ID No. 3). 
     
     
         6 . The method of  claim 1 , wherein the anti-clusterin antisense oligonucleotide consists of a sequence as listed in any one of Seq ID Nos. 4-12. 
     
     
         7 . The method of  claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered once in a seven day period. 
     
     
         8 . The method of  claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered 3 times a week. 
     
     
         9 . The method of  claim 1 , wherein the anti-clusterin antisense oligonucleotide is administered on day 1, 3 and 5 of a first seven day period of a treatment cycle. 
     
     
         10 . The method of  claim 1 , wherein the patient suffers from a cancer selected from the group consisting of prostate cancer, bladder cancer, ovarian cancer, lung cancer, renal cancer, melanoma, and pancreatic cancer. 
     
     
         11 . The method of  claim 10 , wherein the patient suffers from metastases. 
     
     
         12 . The method of  claim 10 , wherein the patient suffers from cancer with lymph node involvement. 
     
     
         13 . The method of  claim 1 , wherein the method further comprises the administration of a chemotherapeutic agent. 
     
     
         14 . The method of  claim 13 , wherein the method further comprises the administration of hormone ablation therapy. 
     
     
         15 . The method of  claim 13 , wherein said chemotherapeutic agents are cisplatin and gemcitabine. 
     
     
         16 . The method of  claim 13 , wherein said chemotherapeutic agent is taxotere. 
     
     
         17 . The method of  claim 12 , wherein the method further comprises the administration of radiation therapy. 
     
     
         18 . The method of  claim 10 , wherein said lung cancer is non-small cell lung cancer. 
     
     
         19 . The method of  claim 10 , wherein said cancer is prostate cancer. 
     
     
         20 . The method of  claim 10 , wherein said cancer is renal cancer. 
     
     
         21 . An antisense-containing pharmaceutical composition packaged in dosage unit form, said pharmaceutical composition comprising anti-clusterin antisense oligonucleotide, wherein the amount of anti-clusterin antisense oligonucleotide in each dosage unit is from 40 to 640 mg. 
     
     
         22 . The antisense-containing pharmaceutical composition of  claim 21 , wherein the antisense has a sequence selected from among Seq. ID Nos. 1-12. 
     
     
         23 . The antisense-containing pharmaceutical composition of  claim 21 , wherein the amount of anti-clusterin antisense oligonucleotide in each dosage unit is from 300 to 640 mg. 
     
     
         24 . The antisense-containing pharmaceutical composition of  claim 21 , wherein the composition is an injectable solution or suspension. 
     
     
         25 . The antisense-containing pharmaceutical composition of  claim 21 , wherein the composition is an aqueous solution comprising sodium ions. 
     
     
         26 - 30 . (canceled)

Join the waitlist — get patent alerts

Track US2016168577A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.